Description :
From Genome Similarity Track
Location :
Scaffold_357:8414- 9920
Sequence
1506 bases(100 bases per row)
GCTAATTAGAAGCAGGGAGGTGGGTCCGACATTTTTACGTCCTCGCATCAACGTAGCGGACAATCATATATTGGTCAGGGTTAGTAGATGTGGAGCACCA
TACGGACCAGGCAACGTCAAGTGAGTTTGCAGGCCTCTTGATGAGAGTTTCTCCTAATACAGAATCGCTGTGGATGACTGAATGTGGTAATTAGGGTTTC
TCACTTCACCTTGACGATAGAAGTGTCGAAGGATATGTCATTTCGAGCCCTAGTCAATTGTGGGGCGTCGAACAACTTGTACGACTCCAATCGCTATATC
ATCGCCGGCTCGAGTTCGTTGAGCATGAGATCCCTCCGTCGAGGATGGATGCACGCCTTGAAGCAGGCGCATTCGTAACAGTGATTAAGCTTGTCGTGGG
ATTCGCTAAGCACTGAAAGAGGTACAATATGACGTTTACTTCATCGTATTAGACATGGATGACAAGTTTGATATCGTCATGGATTTATGTTTTCCTTAAA
TGTTGCGTCCAATCGCTGCTGGGGTCTCGTGAGTTCTCGTGCGATCCAGGCCAAATATCCCGAGATCAGACTTCGCGATATTTGCTAACATTTTAAATTC
AATCTTTTTGCCTTAAGATACGTGTGCCTTCAGCCGTCGGGAAGCCAAAAATATTGATGAAATAAGGGGATGCATGTCTTGAGCAGAAAAGGTTGAATTC
AAGTCTGATTATTCGTCAAACAAACTAAGCTACCTATCATTGTACATACCCTAAATTACAGAATACCATCCAGATCTATATCACTTTAAGCTAGACCACC
CCCTTGAACACGTGCCGAAATTTTCGGTCTATATATCAATAATCACACGGATAGTCACAATAATGTGCTCTCGAATCGAAATATTACCATATCTCGAATA
ATGCTATTGTATCCAGAACATCTTGATTATATCCATACTGTTAGAAATATATCCAAATATTGAGCCAAGTATGTGTGAATCAACGTTATAGCATCAATTC
GGACACCTTCCACCGGTTCGTTTGATCTGAACTTTCGGAGATCGGCTTCCATTATCTTTACTACCTCTCCTTGCCAATTGTTTCCATCTAAAAACGCCAT
TAGATGTCCTTTTACGAATCTACATCCCGATATCATATCTATTTTTGCTATATAGGTGGGTGTGTGGTGGCACACTTTCGATCTGTCTTGAGTTGGTCCA
CACTGCCATATCACATGCTGTCTATAGTCAAATCACCTGGACTTAGTTATACTTTTGCGAATAAATTGGACCTAAATTCGTCCCTGAGAATCAACTTAAG
ATAGTGTCAGATTGGTTAATACCAGGCATATCACTGGTCTTACCAGTCGGTATAATATTCCGACTGTTGGGTGCCTCGTTGCATAAATAAACATCATCCT
TGTCCCTATTCCATCAAATCATACACCCCACTTGCCATATAGCGTGATATTGGTATAAAAGAGTACGGTAGCCCAAGATCCGCCCTACGTCTGTAGCGCA
TACCGG