Description :
From Genome Similarity Track
Location :
contig_93:84124- 85822
Transcript NameFunction/comments
g13220.t1XP_009525659.1 putative endo-1,3-beta-glucanase [Phytophthora sojae

Sequence
1698 bases(100 bases per row)
CGGCCGGGTGGCTGCAATGTACAGCGCCCAGGAGCGGGAGAGCCCGTCATCCATCGTGACGTTGCGCAGCTTTTCAAGCGCGAACGCCTTGTTGACGGTG
GCGTAGTTCATGTAGAGAAGCGAGAGCCACGGGTTGGTCTGCTCGTCGTTCTGGACGATCGGCTCGCGCGACAGGACCTGGTCCCATTCCTGTGAGACGA
AGTCGTGCGTGCGCACAAACTCGGTGACGGCCGTGACTGGGAGCATCTGAATGCCGTGGATCGCGTACTTCTCGCCGCTGAACCACGTCGCGTAGGTGAC
CTTGTTGTCGAAAAGGATTCCCATGACCTTGTTGTCACGGTAGCGGTCCGGTGGGCGCGGTTACCGTCCTCGATCAGGAAGTACGTCTGGATCGCGCGGG
CGTTGAGCTTGACCATAAGCTTGCCAACCGTTTCAAGGTGGGCGTCGCCTGTGGCCTTGCCCAGCAGTGCCATGCCGTAGTAAAAGTTCATGTCCTCGGA
CGTGCTCTCCTCGTCCTTGCCATCTCCAAGCGCCGTGATGCCGTGCGAGTACGAGTGGCCACGATACCAGTCAAGGCTGCGGAACTTGGGGAAGTACGGG
TCCGCGTCCGACGGGTTGGCGACGTCGCGCACCAAGAAGCCCGCCATGCGGTTCAGCTCGGGCAGCTTCGACCAGGTCGGGTCCAGCTTGTTGATGATAG
CGACGGTGACCACCCAGTAGCCGTAATGGTAGTGGTGGTCGTTGTACATGGTGTTGCCAAAGTCAACGTTGGCGTCGTGGAGCGTGAAGCCCTGCGAGCT
CACCACACCACGATAGATAGTGTCGTAGTTGAGCGCGTTAGTCCACGTGTTGTTCAAGAACGGCGTGAGCATGCTCTCCAACTTCTTGATGCAGTGCGGG
AGCAGCGTGGTGTCTTCGCCGACGATGGAGGCGTCTCCAGCCATCAGACACATCGACGCGTACTTCTGCGCGGCCTTGCCATTGAAGTAGTAGCTCTGGC
CCAGGGGGATCGACCACTCGGACTCGATATCGGCGATGAGCGTCTTCTTAATCTTGTACGACTCGACATCGCTGGCATCGGGTTTCCGCGGCGGGTAAAA
GTCAACGGGGAAGTCCACCGTTTCCACAAGACGCCACTCGGGCGGCGCAGTCTTGGTCACCACTCCCTGCATCAGTCCGCGCGTCGTGGAGTGAGCAGCT
ACGCCTTCAGCCTCCACAGCGTATCTGCGATCCAGCGTGTCGATGTGGTGGACCTGGGCGTAGTGCAGCAAACCGTTTCCACAGTCGCCGCTGGTCTTCC
ACACGTACGCGTAGGCGTCTTCATTGTGGGCTTCAACACGGCCACCGTCGAGGACGCAGCCCGCCGTCTGGTCGAAGACGTTCTGCTCTTGCGCAGAGGC
ATCGGGGATCAGCGCAACACGAGCAATGCCAGTGAATGGGCGCTCCATGTCGAGCACAGAGTGGCCATCAAAGTGCAGCGCGACCGGAGAAGAGAAGTAC
AGCGTCCAGGTTGCGCCGTTGTCGAACTGCAGCACGAAGCGGCTGTTGGTAAGAGGAAGGCTGACGGTCTCCGTGGCGTCCAGGCCGTTGATGGTCGAGA
TGTTGTACGCCGTCTGGAACCGCGGCGTCAGCTCAGTGTATCGAGCAGTGACGAAGGCCATGCCGCTTGCGAGAGTCACCTCGATCTTCTTCGCATCA