Description :
From Genome Similarity Track
Location :
contig_93:84047- 85745
Transcript NameFunction/comments
g10783.t1putative endo-1,3-beta-glucanase

Sequence
1698 bases(100 bases per row)
CGGCCGGGTGGCTGCAATGTACAGCGCCCAGGAGCGGGAGAGCCCGTCATCCATCGTGACGTTGCGCAGCTTTTCAAGCGCGAACGCCTTGTTGACGGTG
GCGTAGTTCATGTAGAGAAGCGAGAGCCACGGGTTGGTCTGCTCGTCGTTCTGGACGATCGGCTCGCGCGACAGGACCTGGTCCCATTCCTGCGAGACGA
AGTCGTGCGTGCGCACAAACTCGGTGACGGCCGTGACTGGGAGCATCTGAATGCCGTGGATCGCGTACTTCTCGCCGCTGAACCACGTCGCGTAGGTGAC
CTTGTTGTCGAAAAGGATTCCCATGACCTTGTTGTCACGGTAGCGGTCCGGTGGGCGCGGTTACCGTCCTCGATCAGGAAGTACGTCTGGATCGCGCGGG
CGTTGAGCTTGACCATAAGCTTGCCAACCGTTTCAAGGTGGGCGTCGCCTGTGGCCTTGCCCAGCAGTGCCATGCCGTAGTAAAAGTTCATGTCCTCGGA
CGTGCTCTCCTCGTCCTTGCCATCTCCAAGCGCCGTGATGCCGTGCGAGTACGAGTGGCCACGATACCAGTCAAGGCTGCGGAACTTGGGGAAGTACGGG
TCCGCGTCCGACGGGTTGGCGACGTCGCGCACCAAGAAGCCCGCCATGCGGTTCAGCTCGGGCAGCTTCGACCAGGTCGGGTCCAGCTTGTTGATGATAG
CGACGGTGACCACCCAGTAGCCGTAATGGTAGTGGTGGTCGTTGTACATGGTGTTGCCAAAGTCAACGTTGGCGTCGTGGAGCGTGAAGCCCTGCGAGCT
CACCACACCACGATAGATAGTGTCGTAGTTGAGCGCGTTAGTCCACGTGTTGTTCAAGAACGGCGTGAGCATGCTCTCCAACTTCTTGATGCAGTGCGGG
AGCAGCGTGGTGTCTTCGCCGACGATGGAGGCGTCTCCAGCCATCAGACACATCGACGCGTACTTCTGCGCGGCCTTGCCATTGAAGTAGTAGCTCTGGC
CCAGGGGGATCGACCACTCGGACTCGATATCGGCGATGAGCGTCTTCTTAATCTTGTACGACTCGACATCGCTGGCATCGGGTTTCCGCGGCGGGTAAAA
GTCAACGGGGAAGTCCACCGTTTCCACAAGACGCCACTCGGGCGGCGCAGTCTTGGTCACCACTCCCTGCATCAGTCCGCGCGTCGTGGAGTGAGCAGCT
ACGCCTTCAGCCTCCACAGCGTATCTGCGATCCAGCGTGTCGATGTGGTGGACCTGGGCGTAGTGCAGCAAACCGTTTCCACAGTCGCCGCTGGTCTTCC
ACACGTACGCGTAGGCGTCTTCATTGTGGGCTTCAACACGGCCACCGTCGAGGACGCAGCCCGCCGTCTGGTCGAAGACGTTCTGCTCTTGCGCAGAGGC
ATCGGGGATCAGCGCAACACGAGCAATGCCAGTGAATGGGCGCTCCATGTCGAGCACAGAGTGGCCATCAAAGTGCAGCGCGACCGGAGAAGAGAAGTAC
AGCGTCCAGGTTGCGCCGTTGTCGAACTGCAGCACGAAGCGGCTGTTGGTAAGAGGAAGGCTGACGGTCTCCGTGGCGTCCAGGCCGTTGATGGTCGAGA
TGTTGTACGCCGTCTGGAACCGCGGCGTCAGCTCAGTGTATCGAGCAGTGACGAAGGCCATGCCGCTTGCGAGAGTCACCTCGATCTTCTTCGCATCA