Description :
From Genome Similarity Track
Location :
contig_39:84040- 85241
Transcript NameFunction/comments
g8504.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
TCTCTCACTTTCCAATTCTTCGCTGACGACAACAATGGCTCCTCAACAGCAAGACACACAGGCGGCGGCTTCGACCAACGCTGCGCCCACCATCGTGCAA
AGGTGGTGGCGACCCAGACCAACACAACTGAGACCAAGCCGGTACCCGTGAAGAACGCGCTCAACGACCAAGTGGAGCACTTCCCCTTCGAGCACCCAGA
GTTACTCAGTGTCTACCCTGAAACCAAGTACGACCCGATCCCAGTGCTGCCGTACGAAGACCGTGCGTTGAAGGCCGACCCGACGTTCAAGAACCTGCTC
AAGACGCCACAGTGACCCACCTAGCACCGAAAATCGGCACGGAGTTGAGTGGCATCCAGCTGCACGAGCTTTCGGACGCCCAGCGCGACGAACTCGCGCT
GCTTGTGGCGCACCGCGGCGTCGTGTTCTTCCGTGACCAGGAGATTGACGTGGAGCAGCAGCTGGAGCTCGGACGCCACTTTGGTCCTCTCCACGTGCAC
CAGAACTTGGGCCATCCCGAAGGACACCCGGAAGTTCTGGTCGTGCAGAACACCGTGGAGCAGCGACCGCATCCTCAAGCGGCAGCAATACGACCCGGAC
AATGTCTGGCACAGCGACGTGTCGAACGAGCGCCAGCCGCCGTCCTACACGAGTTTCAAGGTGCTGACCAACCCGCCACTTGGCGGTGACACTTTGTGGG
CGTCTGCGTACGAGGCGTACGAGCGTCTTACTCCTCCTTTCAAGAAATTCATCGAAAGTCTCACCGCGATTCACAGCAGCAAGGTATGAAAGTTTAGTTG
TTGAGGCTTGTTACTCCGCTGTGTACTAACCGCATTGACATTTGTAGGGCCAAGCTGAGCGAGCAAACAGTCGTGGACACACGATTCGTCGGCCGCCGGT
GGAGTTCGAGCACCCGGTGGTGCGCACCCACCCGGCCACCGGTCGCAAGGCGCTCTTCGTGAACCCTGCGTTCACCACGCGCATTGTGCAGCTCTCTTCT
CGCGAATCGGACGCGATCCTCAAGGTGCTGTACAAGCACATCACGGAAGGCCACGAGTTCCAGGTGCGCTTCCGCTGGACCAAGAACGCGGTGGCCGTCT
GGGATAACCGCGTCACTGCCCACTACGCAACTTTCGACTACCTGCCAGGCAACCGACACGCGGTTCGAGTGACCACGCAGGGCGAGATCCCGTACTTGGA
C