Description :
From Genome Similarity Track
Location :
contig_87:84037- 85693
Transcript NameFunction/comments
g12935.t1RAW26372.1 Elongation factor [Phytophthora cactorum
g12936.t1XP_008906115.1 hypothetical protein PPTG_12170 [Phytophthora parasitica INRA-310

Sequence
1656 bases(100 bases per row)
CGATCGGGCACGTGGACCACGGCAAGACGACGCTCACGGCCGCCATCACCAAGGTGCTGTCCGAGACTGGCGGCGCCGAGTTCACGAGCTACGCCGACAT
TGACAAGGCTCCCGAGGAGCGCGCGCGTGGTATCACCATCTCCACGGCCCACGTAGAGTACGAGACGGACAAGCGCCACTACGCGCACGTGGACTGCCCG
GGCCACGCCGACTACGTCAAGAACATGATCACGGGCGCGGCCCAGATGGACGGCGGCATCCTCGTGGTCTCGGCCGGCGACGGCCCGATGCCGCAGACCC
GCGAGCACATTCTGCTGGCCCGCCAGGTGGGCGTGCCGGCCCTCGTGGTCTTCATGAACAAGGTGGACCAGGTGGACGACGAGGAGCTGCTGGAGCTCGT
GGAGATGGAGATCCGCGAGCTGCTCGAGGCCTACGACTTCCCGGCCGACGACATCCCCGTCGTGCAGGGCTCGGCCCTGGCTGCCGTGGAAGGCCGCGAC
CATACCATTGGCCGCGACGCCGTCCTTAAGCTCATGGACGAGGTGGACGCTTACATCCCGGACCCGGTCCGTGACTTCGAGAAGCCCTTCCTCATGCCCG
TGGAGGACGTGTTCTCCATCTCGGGCCGTGGTACCGTCGTGTCGGGCCGCGTCGAGCAGGGCGTGATTAACACCGGCGACGAGGTGGAGCTCGTGGGCCT
CAAGGCTAGCTCCAAGACCACGTGCACGGGCGTCGAGATGTTCAAGAAGTCGCTGGACCGCGGCCAGGCCGGCGACAACGTCGGCCTGCTGCTGCGCGGC
CTCAAGCGTGACGAGGTGCTGCGTGGCCAGGTGCTGTGCAAGCCCGGCACCATCAACCCGCACACCAAGTTCGAGGCTGAGGTGTACGTGCTCAAGAAGG
AGGAGGGTGGCCGCCACACGCCGTTCTTCAGCAACTACCGGCCGCAGTTCTTCTTCCGTACCGCCGACGTGACGGGCGACATCCAGCTCAAGGCCGGCAC
GGAGATGGTCATGCCTGGCGACAACACGGCCATCGACATTGAGCTCATCCACCCCATCGCGCTGGACAACGGCATGAAGTTCAGCATCCGCGAGGGCGGC
CGCACCATCGGCGCTGGCGTCGTGTCCAAGGTCGAGTCGTAGATATTTTCTGCAGAACGACTGCAGTAGATGCGTGGGAGCGAAGCAGACGTCGGCGTCG
TGTCGAGCTTCGTATACCAACAATACATACAATCACTAACACGCAGTGCCGCGTCAACGTTTGATTCTTGTGCCATGATTTCAAAGCTTCATACATCCAA
TGTTATGCCGTTGCTGTCTATATTTCCAATAACTGTCCTCTGACGTCTCATTTAGTCAAGCTCGTCGACGCTAAAGAATTTCTGATCCCGTGGTGCTGAG
GTGTCATCGGTAGTGTAGCTCCTCGAAAACTGGCGATCGGGTTTGTCCTGACTTGGAGGAGGCATCGAGCCGCCCGGGTTGAAACCTTTCGTGTAGCTAT
TCGTTCGTCGCGAGTTGCTGCTGCCGGCCGAGTCGCTGTTCTCTGAAAACTGCGGCGGGTTGAGGTGGCCGGTCTCCCGCAAAATGCCGGAGAAGTAGTC
GAGCTCTTCCTGGTTCCACTGCAGCTCCTTGGAGTTCGCGACGCTCGCTCGCCCCA