Description :
From Genome Similarity Track
Location :
contig_39:84036- 85237
Transcript NameFunction/comments
g8135.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
TCTCTCACTTTCCAATTCTTCGCTGACGACAACAATGGCTCCTCAACAGCAAGACACACAGGCGGCGGCTTCGACCAACGCTGCGCCCACCATCGTGCAA
AGGTGGTGGCGACCCAGACCAACACAACTGAGACCAAGCCGGTACCCGTGAAGAACGCGCTCAACGACCAAGTGGAGCACTTCCCCTTCGAGCACCCAGA
GCTACTCAGTGTCTACCCTGAAACCAAGTACGACCCGATCCCAGTGCTGCCGTACGAAGACCGTGCGTTGAAGGCCGACCCGACGTTCAAGAACCTGCTC
AAGACGCCACAGTGACCCACCTAGCACCGAAAATCGGCACGGAGTTGAGTGGCATCCAGCTGCACGAGCTTTCGGACGCCCAGCGCGACGAACTCGCGCT
GCTTGTGGCGCACCGCGGCGTCGTGTTCTTCCGTGACCAGGAGATTGACGTGGAGCAGCAGCTGGAGCTCGGACGCCACTTTGGTCCTCTCCACGTGCAC
CAGAACTTGGGCCATCCCGAAGGACACCCGGAAGTTCTGGTCGTGCAGAACACCGTGGAGCAGCGACCGCATCCTCAAGCGGCAGCAATACGACCCGGAC
AATGTCTGGCACAGCGACGTGTCGAACGAGCGCCAGCCGCCGTCCTACACGAGTTTCAAGGTGCTGACCAACCCGCCACTTGGCGGTGACACTTTGTGGG
CGTCTGCGTACGAGGCGTACGAGCGTCTTACTCCTCCTTTCAAGAAATTCATCGAAAGTCTCACCGCGATTCACAGCAGCAAGGTATGAAAGTTTAGTTG
TTGAGGCTTGTTACTCCGCTGTGTACTAACCGCATTGACATTTGTAGGGCCAAGCTGAGCGAGCAAACAGTCGTGGACACACGATTCGTCGGCCGCCGGT
GGAGTTCGAGCACCCGGTGGTGCGCACCCACCCGGCCACCGGTCGCAAGGCGCTCTTCGTGAACCCTGCGTTCACCACGCGCATTGTGCAGCTCTCTTCT
CGCGAATCGGACGCGATCCTCAAGGTGCTGTACAAGCACATCACGGAAGGCCACGAGTTCCAGGTGCGCTTCCGCTGGACCAAGAACGCGGTGGCCGTCT
GGGATAACCGCGTCACTGCCCACTACGCAACTTTCGACTACCTGCCAGGCAACCGACACGCGGTTCGAGTGACCACGCAGGGCGAGATCCCGTACTTGGA
C