Description :
From Genome Similarity Track
Location :
Scaffold_441:8400- 10621
Sequence
2221 bases(100 bases per row)
TGCTGCTGTTACTGCTTCTACTGTTGCTACTGCTGATGCTCTAGGTACCGCTGACGCTACTGTTGTTGGAGCAATTGTGGAAAGGCATCTCCGTTCCATA
TCATTAGCTTGTTTTTAATCATATCAATACACCCAATGAATCTATCCTATCTGTTTGGCTCTCATTAGTTTATTCCATGCATTTGGACTTCTTCCTCTGT
AGGCATATAGCTTGAAGAAAACGTTCGATGATGCATCAAGTAAAGTATAGTCGAATCGAAGAATTTTTGCGTTATATTGAACGACAACGTGCTTATATTT
TTTTATCCTGACGTTGTGGTTATGCATTTTATGTATATCTATCATATCAATCATATTTTCGCGGGGTCGATCAGATAGTGCCGTCTAAAGTTGCAATATG
GACAATGCTGTGTACAATTCAAAGGAGACATTCCAGGCACTATGAAAACCGGACATATAGTCGTATTAGTGCTGATGGAGAAATGTAAGTGCTGGTGTAG
AGATGCCAGTGCTTTAAAGGAATTCACCAGCGCTTTAATGACTTCAAATTACAACTAAATGTACCACTTTAGCATGAGTATATAAGGACGTGGGGCATTC
TTTTATTTTCCAATTGTATGGGTAAAAAGGGCAATTTTATATTTCCCCCTCTTTAGACTAATAGGAACTTCGTTCCGTAGAACCAAGTGACTTCTAGAGT
CGTAAGTCTTCCTCTGACTAAAGGCTGTGAACCTTAACTACATTTGCGAAAGGAGCGAGATTTTCGCTGTCCTTGACTGTCAATCGTTGGCTCGTTTTCC
CTGTGTTGGCGCACTTAGTAAGACGCGAAAGGTACATCTAGAGCTATCTATAGTCAGACACAAACACAGATTAAAGGAGGTTTTAAAGTGCGGCATTCAT
CTTGTGCACAGTCGAGGAGATGTGCCAACTTCGAGCTAAGCTTCGCCCGTTTGGATAAGTGTCAGTAAATTAATACGAATAGGCGAGGCCGGAAAGTAGC
TGGATAGATGTCAGGTCCGCAGTCGAAGAGATCACGCCAATAAACATTGCAAAATAGGAGGCTCAAAAAGCGGGAGGAAACATGTGCGAGTGCGTTAAGA
AGCAAATCCATCGAGGCCATTAGACCCACGCTCAGGGAAATTCTTCCATTCGACGAACTTTCCAGATTGATCTGCTGAGACAATACATGGTTTCAAAGGT
CTGTCCAGAGTTGGTTACCAGCAATCTTTATTGACAAGTATTCATGTTTAATCCCCACGAGTCCACGCTTAACGAAAGACTTTTGGCCAATAATGATCCG
CCATTGAGATTCATTGATCCGGATTCCATACACAGGAATGTCACGATAGGTACATATCGTGATCGTGGCTACTTGAAGATACCTGGGTGCCGGGCAGCGA
TACCTTGAACACTAGTTTACCTAGATTTTGTCTCAGACACCGACCGCGGCCTACAGTTGCCCATTCTAATTCTGAGCTGATGTCTTAGAGTAGATCGCCC
CACTGTAAGCACCAATTGACGTCGAACGTTTGCTAGTGTACACATCTAACTTCATTAGCTCTAATCCTTATTCTTTTCATAGCTAAATTGTCTTAATTTG
CCAGAGGGTTTGCACAGCTTTGTGAAACGAAAATTGGTTAAGTTATCATGGTACGTATGGTGCTACGTTAGTAAAGATACTAAGAGCCGATAATAGTTAT
CGATCAATCGAATTTATCCGTCAAGGAGTTGCGGCGGTATGAAAAGAGGGGAATCATACCATAACATAAGTTTCTGAGCGATCTCACCGACAAGCCAAAC
CCACACGATTCAATGATTAAGATCTTTCTTGCATGTCTCCTTTCGTCGGCGGCATTTCTACTAGCATCTAGTTTGTGTATCGATGACATGATTTGAAGAC
ATGCTCATTACTTCTCAATTGTTGGATGTACACACTGTAAAGACGCGAACACTAGCCACAAAATGTACAAAATTATCCACACACTATGTTGCTGGTGGCA
CTCCTGATACGGCAGTAGTGTGCGTATGGTGTTTAACGGCGGCTAACTTTAATTTAGTGTAGGATAGCCACGGTGTTGCATTGCAAATAAAAACCTTAAT
CGTGTAATCTGTGTAGCATTTCACCTCAGGGTAGAGCTATCAGAATGATGCCCTGTTTTATGCAACGAGCACGAGGTACAATCTGCGCAGCCCTACAGAT
TCTCCAAGTGAAACAAAATAA