Description :
From Genome Similarity Track
Location :
Scaffold_27:8400- 10174
Transcript NameFunction/comments
Phyta_totarag1439hypothetical protein

Sequence
1774 bases(100 bases per row)
GATGATCAATTAATCTCGTGTCAGTTTGATGCTAAAATATTTAGCTTAAGTTACAGTAATTTTTAAAAATTACTTTTACTTTTTTTGCttaaaaacaaaa
acagCACACCTCAACTCACATTTAACATCGCGGTAAGTTGCAGGCTGCCACCCTGAGTCGATCGAGGAATCCACAAAAGCAGCGAACCACCTCCAGTGCC
GGGAAGTTCCAAAAATCCCGGACGCCATCGATCCAAATACAGCGTTTTTCCTCCCAATGTTGTCACGTTCGACTTCCAAGTTGCGGTTTGACCAGCTGGG
ACAGCCACTtcgtcgatcttgtcgcCACCAGACTTGATGTTCACGGTCACATCTTCGGTATCAACGCTCTTGAATGTAATGGTGATGGTGCCGTCGCCAA
TCTTAGTCCACATGCCGTCACTGTTGTTAAAAGCACCTTGGACAATCGACATGCCCAGTGCTTCTTTCACATTGCCATCATCGATCTCCCCGATGAGCTC
GGTGGGGCCGCAAATGGGTTGAACGAAATTGGAAATAACAGAAGAAACGTAATACGGGTCCCAAATGGAGTAAAACCCAATGGCTGTATCTGCAATCTTG
AAAGCATACTCCCCAGCAGTGAGATATGTGCCGTTATTACTCGTTCCCGATTTGATTAGGTCGTCTACGATGACTCCAAAAGTCTTGCGCAGAGTATCAC
GTATGGCGTATGCTGTCGTTTCATCCGCTTCTGCGACCAGATCGCCCATACAATTATTTGTTGCGATAGGGATATCGTTGAGTACGAGGTTCGACTGACT
CATGACCACTCGAATGTCGTCCTCAGACATTTCCGGGTTCTGGCTACGAAATTCAGCCACAGTCATCCACGTGCGATCCAACAGACGCTTCATGTCGTAG
CCACAGGTGGAATTGGACTTCAGCGCGGACTTTAATGACGTGATGTCAGTCTTTTTCAATGAGGCAATCGAATCGCCTAACGTAATATTCTTCATAAAGT
TCGTGAAGGATTCCCAACTGGAGAGGATAGCGGCACCATTTGATATGATTTCTCTCAAAGCGTACTCTGCAGTCGTGAGTATACTGTCAGCGAACTTGAC
ATTATCGGACGCTTTCTTCCCTATGCAGTAGGAAATAGCCACAGGTATGTCGATGATGACGTTGTCAATCTGGTACAGCATGGTGAGGATCTTATCTTGT
GTTGCTTCTGGATTGTAAACCTTGATGTAGCGGATATACCTGATCAGCGACTTGGAGAGACTGATCATGTACTTGGTACATTTGATAGCGCGTTGAATAC
TCTTTGCCCACTTCGTCATGTCACCGTAAACACCCCACGCGGAGAGGGAAAGTGCCGTCTGGACCACAACTGCAACCTTAGACACGATTGCAAGTCCACA
GTCATCATTCTGTCGGATACACTCGAGTCCACACTCGACAGGATACGAATAAGGACACTGTGTCCAACACATTCCGAGCATCCTGTCGAATCCCAGAGGA
CACGTCTTCGCGATGTGAGCTCTGCGCCAGCACgcggaggaagatgaagtgtCGAGTGCGGTACCAACCCAGTTGGTGTAGGTGGGTTCGATCGTGCTAG
TCGCGTTCAGCACGCTGCCGAGCTTAAACGCAGCATTCATGGACGCCAACACAACTGTTGATGTGGCTGCAGACACGGTATTCGAGACTGGGATGGTTGA
TGAGATATCGTCTGAGTCGTTGCTGTCTTcaacgccatcgtcgtctgaaTCGCCATagtcgtcgtctgctgctt