Description :
From Genome Similarity Track
Location :
Scaffold_1164:840- 4551
Sequence
3711 bases(100 bases per row)
TTGAATTCATACAGAAGCGCATCACAATTGAGCCTAACCACTCAGGATCGTCGTATCCTTTCCACTTGATCAGGTACTAGCGGAATCTCTTGGAAGTACG
AGTGCGCTTGGCCCACCGGAGGTCCAGAATCTTTTCCACTTCGTACTCATCATTCTGTTCGTCCGGCTCCCAGCTGTCCTCGGGCAGCAGGGCTGCATCG
AAATCGTCGTCATCATCCCGATCGAGTTCCGCGGTAGGTAGCTTCGTAAACAGAGCGCGAGGCTTGAGGCGGCTGATGTGTACCCAGGGGTTAACACGAT
ATCCTGTGTCCTCCACCTTGAGTTTCACTCTGAAGTCATCGTGTACCTCTTCGATCCTGAACGGCCCATGCCACATGTGAGCCAGCTTGCTGCTCAATCC
GGTCTGGACTTTCGGGATGTAGAGCCATACCGAATCACCTTTCTCAAATCCTGTCTTCAGCCTCACGCACAATTCTCTCCACTTGCGTGTCTGTTCTTCC
GATCGTGTTCGCTTCGCTTGTCTCTGGAGGTCCTCGGCACAGGCTATTGCGTAGCTGTAGTCGCGCTGAAATTTCCGACGCCACTCGTACGCAGTGCGTT
CAGGCACACTAGATGCTTTCGGACCTAACATCGCCGTCACCGTGCCTTGCGCATCCCAACCGTGTACCAGATAGAATGGAATGTCCAATCGGGTCGCGTC
GAACGAGGTGTTGAGGGCGAACATCAGTCGCTCAGCGTGATCATCCCAGTCAGACTGGTCAGACTCAGCGATGTAAGCGCGGACGCTTCGGATGACGGTC
TGCACGAGTTCCTGTTGGCCGTTCGCACGATATGCCAACGTGGCGCGCTGACGACTGCCGAGTAGCTCCCGAAACCGAGTGAAGACCTCACTCATGAAAC
GTGGGTCTTGATCGTGTCTGATCATCGACGACGCACCGAAATTCCGGAAGACTCGCTCTTCATAGGCCTCTGCTACATCCTGTGCCGTAGTAGACGACAT
GGGTTTACACATCACGTAATCAGAGAATGAATCATGAAAAAGCAGTAGGAAGGTGTTCCCTCGTGCCGACTTGGGCATGTGCGTCACAAAATCCATCAAC
ACAACTTCAAACGGGCGCCTGGGCTCGATGTTACCAGGTGACGGTCCAGGGTTGGGAGGTCGCCCCTTTCCATTTGCACAGTCAACGCACTCCTTCACAA
AACGTTCCACGTCGGCATACATGCCGGGCCAGTAGAACTCGGGCGTAACCGCTCGTGGGTGCGGGTAATTCCCTGGTGTCCACCTTGAAAGTCCTCGTGA
GCGTAATGCAGCAAGTCAGCGTGCAGTGTTTGTGGCACCACAAGACGTGGCTCATCCTGTACGTCCCGAGGTCGATCTCGAGTAGACCGCGCGAGTCGAT
ACAGGATGTCTCTGGCATCCAGTGCAAACAAGTCCGAGAGCTTCGCGATCTTGCGAAGCCGCCTCGAAGAGAATCGATCCAGGTCGCCACTCAGATACGC
TTTGACTTCCGAAATGAACTCATCCTGATCTTGGTGTGCCTTAATCCTGCGCCACCTCTCGGCTTGGAACTCCAACGGACCCAATGGGCCACTCGACTCT
GTCTGTTCCTGTGTTCTCGATCTGGTCAGGACCGCCATGACTCGAGCACAGTGAGGTAACGGAGCAGAACCGGGGTCCTGTTCGACATTGTCTGGTGACC
CCACATCCGGTGTCACCACCTTCTTAGCAGCCGATCCATCTGGTGCATCCTGAACTCCCTCACTCACATCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCCTTCGACAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACGGGACTG
CAGCTACCACCGGGAAATCCTCTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCTTCAGAGTAGACGGGAATGGTAGATCCAG
TACGCCCTTAGCGATCTTCGGCGTCGCCCTGAGTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGA
CTGACAGAGATGTTCCAATACCGCAACCGAAACAGTAGCGCATCCAGATCGATGCAAAGTTGATTCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGT
ACGAGCTCCGTCCTAGGACAGGGCCCATCTGCATCGGTGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGACGTCGGCCAGA
CAGGATTTCGTCGTCCGATCCGGTGTCGCTCCCTGCGACGTTGTCCTCTTGCGGCTTCAAACCCAAATAATCTAGTACGTCCTGATCCACCTGAGCTTCC
TTACCAGGTGGTAGTCGAACAAAGCCCCACAGACAGTTGTTGAGCATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATGCGTCGCCACT
GGTAGTGACCGAACGGCGACACGAACGCCGAGATGAGCTTCGCTCCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTCATAAACCACATC
GCGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAATCAATGCACATCCGGA
TGTTGACCCCGTTCTTCTTCAGTACGATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAACTTCTTCAGCAACGC
GTACACCTTCATCGCAAGGTGTGGCGCGACCGAGCGTGCCCTCTGTGCGACAGGCTTAGCGTCTCCACATCCAGATCGCAAACAACTCCGCGAGCTGGGG
CAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCTCACGCCAGGTTCGCC
AACATCAGCCTTGTCAATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATCGCTCCCTTCG
TGAATGTACAC