Description :
From Genome Similarity Track
Location :
Scaffold_353:840- 2468
Sequence
1628 bases(100 bases per row)
GTTCGATGCTGCCAGCTGACCCTTGGCTCGTACCTTCTAAGCCAGGGTAACCCTAGGATGACATCAAATTTGTTATCCAAATCAAGTACGATGAAATCAT
CGTTGTACTCCAAAACTTTTAACGTGTAGTGAAATCCCACTACACGTTTCATCACTGCTGTAGATGCACCTGTTGCGAGGCGCACCGTCAGCCTCGTTGG
AGAAGTAACGCGCTCAACGATCTTGAGCCTACGATCCTCTAGCGACTGGCGACGAACAAATTTGTTCGACGCCCCACATTCAACTAAGGCACGAAGTGGC
AAACCCTTTATCACTTCCAAGTTCAAGATGATGAGGGGTACTTCATCACCAAGTGCAGAGACACACAAGGATTGTAAATCTGGAGAAACTTTCATCAATT
GATTTGCAAATTCTGTTGAGATTGCTGGATCAGTAGGGCGCTCCGCCTGTACTGATCACGACCGTTTTTTGACGGTCCGCCACGCTGTTGTGACTTTGCA
ACAGCGTCAGACCCGCGTCCGTTGCCCTTCTTGGCAGACGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCGTGAAGCACTACACTCGTAGGCGT
AGTGTCCTAACTTCTGACAGCGATTGCACTTTTGCGATCGCTTACTGCTTGAAGAGCGAGGTCTCACGCTCCTCAACACTGCAGAAGTCCATTGGTTCTG
TACCTCCCGCCTCTACTTGTCTCGAAGAACGATAGGATGTCAAACTAGTGTGAGCCTGTCTCACACTGAAGTCGTCTTGCACCGTAATCGCTTCCTCAAG
CGACTTCAACTCGATGCGGAATAGGTGGTTCTTCACGGGACCATCTATAAGGCCCTGTACGAATATCGTGATCAACACGAGTTCACTTACAAGGTTCGCT
ACCATGCAACTTGCAAGGTAACGAACGTACTGACCATAAGCGTGAACATCACGCTTACCTTGTTTTATCTTTAGGAGCTCTGAAAGAGTCCTGAACTCAG
CTCTTGGCGGCTCAAACGTTTGGCTGAGCAGAGTCTTAAAGACCGCCAACGATCCAAACACGTTTGGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCT
GGCACGCCCTGAAAAATTCGATTTGGCAAATGCAACTTGCATTTTCTCATCGTCGATGTGGCAAGCCTTAATGGCATCGTCCGCTTCGAGGAACCATCTC
AACAGGGAGTCTTTCTCGACTCCCCTGTACTTGGAGACTTCTAGCTTTAGAGTCTCGCGTCGACGCTCACGTGTCGACGCTGCAGTAGCATACTGAGACT
GTTGCTGTCTCAGGAGCTAAGTCTGCTGGTGACCGTGCTGATGCAGCAGGGTCACTTCAGCTTGGGACGCGTCAAGTTCTTGTTGCAAGAACTTGGCGAT
TATGGAATGCTGTTGGTCCCTATCCCTTGAAAATAGCAGAGACCAGACAGCTTCTTCGCCAACGATCGAACTCATTCGTTCGACCGCACTCCATTCGACA
TCACCCAAATAGGAGTGACTTTCACGGGTGCCGTGAAAGGTGTCGTCGCCTTCGTCGTCCAACATGTTCATGCTGAACGGGTTTTGTGGTCCTTGGACGG
ACTACAAAGTACTACCAGGTGTAACGGG