Description :
From Genome Similarity Track
Location :
Scaffold_129:840- 2065
Sequence
1225 bases(100 bases per row)
TGCGTAGTTTGAGATCTTCTTGATGATTCGGAATGGTCCGTGCCACAAATGCGCTAACTTTTTCTTCACTCCAGCATCCACCTGGTCGATGAAAAGCCAC
ACTTCGTCCCCTGGTTGTAATCGCTCGCCTCGATCTTCTGGCAGCCGGGAATTGAAGTCTTCTGCTCGAAGGGCTTGGGCCTCAGCTATAACATCCTTTG
CCAACCCTTGGGCGTACAAGTATTGCCGTTGCATCCTCATTCTCCAGCGCCAGTTCGCCGTGGCCCCCTCAGTATGAGTGGTTGGTAAGCCAGCTGACAG
TGTAGTTTGAGGGTCCCACATGAGATAGAAAGGGGTCTCGTAAAGGGGTCTCATGTCGTGTGTTGGAATGGATGTGTTCACTGCAAATACCAACCGTTCT
GCAAAGTCGTCCCAGTCCCTCCGAGTTGGATCTTCAGAGTAAATTCGAATGGCTCTGAACAGGGTATGGATAATCCGCTCCGTCTGGCCGTTCGCTTGGG
GTCTGTAGGCTAATGTTGGCATCTGCTCTTGTCCCAGCATCTCATTGAAACTTTTGAACACGGCGCTCATGAACGCAGCTTCTCCGTCGTGCCTCAATTG
CGTGCAGACTCCAAAGCGTCTAAACACCACTTCTTCAAAGGCTTTGGCTGTGGTATCGGCGGATCGATCAGGGATGGCCTTAACCATCAGGAATGCAGTG
AAGAAGTCCAGAAACACCACCAAGGTTGTATTGCCCCGATTCGATTTGGGCAGCTTCACGGCAAAGTCCATTCCAATGATGTGGAGGGGGTATTCTGGGG
ACAGGTTTCCTGGGGTTGGGGCTCGCAAGTGGTGATTTGGCGGACCTGCTGTTTGGTTGCATTGGACGCATTGCTTGATATGCAACTTGATGTCAGCGTG
CATGTTCGTCCAGTAATAGTTTGGTCGGATCTTCTCATACGTCTTCAACAGCTTGTAGTGCCCACCTTCCAGGCTCGAATGATTCTCCTGCAGGATAGCC
TCCACCATGGTCCTCGGTGCGACGACAGCCCACTTCATCGTCTTGTCTGGTCCTCGTCGATGGCGCCAGTACAGGTGGTACAACGCCCCTTCTTCCCCCA
GCTCGTACTCGTACGCGTGCTTCGCAAGTTTTTGACATAGTTGTGGGGTCAGGTGGTCGACATTTCCACGCAAGTAGTCTTTCATCCGGCTGAGCTCGAT
TTCTTGATCTTGTGCCTCGCTGATT