Description :
From Genome Similarity Track
Location :
Scaffold_2473:84- 3803
Transcript NameFunction/comments
Phyta_totarag14527hypothetical protein

Sequence
3719 bases(100 bases per row)
CCTCTCGAACGCGGCGGCTGGGAATAacccaccacgtcgcggGGCTGACGTACGATGCATCCGCTGCGGACGCATCGGTCACTTTGCGCGTAAGTGCACA
GCACCTGTGCACGGGCAGAGAGGCCAACGTGGTGATGCAGTGCATCGCCACGATGAACAAATACAAAACGCGCGGAACTAGTAGACGCGGGGATCCCAAC
TGGTGAAGCAGTAACGCGTGTCGGTATTGGACCATCAATGAGGACTGCACTCCTCCAGTGAGAGGCATTCTCACTGCAAGCAACAAGATGACAAGCCAAA
CCTTGTCATCCTTGACGTGACTTCGAAGAAAGTGAACTCTCTTCGTGCCTTGGTAGCCACAGGTGCCTCGAACATCTTTGTTTGACAGCAAAGTATATCA
AGCCTTGCCTTCGAGGAAGTGCAAACACCTCGAAGCGTATTGAAAGTACGGCTGGCAACAGGGGCCGTCATGAAGACTGAGAAGCATGTCGCTCCCGTAC
GCTTCTCGTATCAACAAAAGAAATTTGTTGAATACCTTATCGTCTAAGCTTTAGACGCCAAGTTCAACTTGATGCTGGGCATGCTGTGGCTTGTACGACA
TGATCCAAAGAGGTAGTGAAAGAAGCGTACAATTGTACGCTTCGGTTGCGATAGCGCGACCGTGAGCGATGGCCCTGTCAGTGCAACACATACACCACAA
GATGCATGCGACCTTCCAGTGGATACATCACTAAATGCTGCTGTCTCGACGCGCAGGGCGCGAATGAGCTAAGCTCCGACGACTTCAGAAGTCGTTGGCT
GTGAATGTGTGTCGATTCTGGGAAGCGACACTGAGAATCTGGTAAACTCAGAAAATAAAGGATGATTCCACCAAATAAACATTGTGACGGCGGCGAGGCA
GCTCAGGGAGCTGACGCGAATGTGATTTGATCAGATTCGGTAGAAATCTTCACCAGATggcgtcgaggcgacgaagacgtgtCAGCTCCGGGAGTAGAcg
ctgcgagcagtgcgGACGTTTGCAAACGTCTAGCACAAGACAAGCTTGCAAACGCACGTGTTGCagggctgcacgaagaagcggGTCATGCACATCAAGC
CTGGCATGGTGATACGCGCCCGCGGATAGAATCGTCCGGCGGCTACAAAGATATCTCATCCATGgctgggcgtggacgaggaaCACGCGGGGCCGGGCTA
TGCAGAAGACGAAACTGCGCGAGCCTAGGCCCAGGACTGAGACGATAAACCAGAAGTCTGCCGGGCAGACATCAAGTCCGacgtccagcgtcgagacACT
GAATGTCTTGACGCAGCCCTTCTGTACAGGAGTATGACGAATGTGTCGGAGTTGACGTCGCTTCCAGTCATGAGTTGGAAGCGCTTCGCGCACGACTTGC
ACGATGGACGCGTTGAGCAGAGCTGCATCTTTTCAGACAAAGAAAGGTTGAAATGCGAGACAGAAGAGTTGAGCAACTCTTCGCTGGCAGTACCACCGAG
AGTGAGGACACTCTCAGcgtcaagacgaagaaacagcgcttcgacgagctgggttgggactcgctcaagtcgagtgCCTATTACGACATTCTTCGAGAGT
ACAAGGACGTACTCCCGGACGACATCCTTGTTGAGCTCCCGCAGGACAAGGGAATTCACCACGAGATAGACCTCGTGCCGGGCATGAAGTACTGCGTCAC
GCGGtagtggccactgccgcgagATCAAGTGAAGGTAATCAACGACATCTTTGAGAGTCGCCGCGAGGCACGTCAAATGCGGGAATCCAAGTCCCCGCAC
GGTGCTCCGACGTTCTGTGTCAAAAGCCACAGGGCGGCTGGCGCATCGTTCATGCTtacaacaagctgaacgatGCGACGACACCAGTGCAGAAGCCGAT
ACCGCGAAAAGATGTAATCATCGATTCGATGGCCAGGAGCACAATCTACAGTGCTCTTGATCTGAGAGATGGATTCGATAAGAACTTGATGCATGAGAGC
GACATTCCCCTCACGGCGGTTAGCACTCCAAGCGGTGTGCTTTGGGAGTGGCTCGTCATGCCTCAGGGGTTAAGGAACGCCCCTGCGACTTTCAATAGGT
GTGTGACGCACTTGTTGTGCTCGGCGCGCGACTTCGCACCGAGCTACTTCGGCGACGTGTTAGTTCACAGCCAGGCTGTGGACGTGAAGACGTATGTTGA
GATGCACAAGGTACGTCTCCGTAAGCTGCTTGGGTTGATGAGCAAGCACAAGCTCTATGCAAACGTGAAGAAGTGTATCTTCAGGGCGAGCGAGATACCC
GTGCTTGGGTGTCTCGTCGGGAAGAACGGCNCAAGCGGGGCTTGACTGAGGCGCCGAGCTTGGCGGTGGCCGACCAAGATCGACCATTCCACGTCGTGTG
TGACGCGTCCGACTTTGCAATCGGATGCAtgttgatgcagctcgatcaCGAGGGTCAGTATCGTGTGGTCTTTTACCAGTCGCGTTAGGTGAAGCCAGCT
GAGCGCAACTATCCAGTACATGACAAGGAGCTCCTTGCCATGAAGTATTCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAATAGACCATTCGTGGTCT
ATACCGACCATGCATCACTGCGTACGGTGATCAAGACACCGCACATCTCCCAGATAATGGCAAGATGGTTGTCATTCTTGCACAGTACAACTTACGGGTC
GAGTAGAAACACGGAAGACTGAATGTGCTGGCCGACGCGTTATCGCGTCGGCCTGACTACATTGTCAAGAAGTCGACGTCAATGCCATTGGTGTCGCTAG
TTCAAGtactccatcgtcgtctctgATCGACGACATGAAGGCCGCGTATGcgcacgacgcagacgcgaaAGAACTGCTTGACTACGtgtcagcaccttct
gaCAAAGCACGTCAGAAGATGGCGCCACACCTACGCGCTCGTGCACATCGTTATCGAGTGCACGACGGCTTACTGCTCTACAGCGCGGTCGACGACAACG
CGGACCGCATTGTCGTGCCTGACGATCATGACCTCAAACTCAGGATCCTGTACGAATACCATGATGCCCCTACGGCAGGGCATCCAGGTCGTGAGAAGAC
GTACGTTCTTCTCACGCGAGACTTCTACTGGACGTACCAGTACAAATGGGTGCGCAAGTACATTCGTGCTTGCGAAGTATGCCAGCGCGTGAAGCCTGCT
CCATTCTCGCAGGCTCCACTACAGTCACTCCCGANCGACATCGTGTCGGACCGTGACCCGCGCTTTACAGCACGGTTCTGGCAAGAAGCGTTCACTTCTT
GGAACAcagctgtcgatgtcgactGCGGATCATCCGCAGACGGACGGACAGACCGAGTGCGTGAACCGCGTGCTcggcgacgtgctcaagAGCTGCGTGC
ACTCGTTCCATCGCTGGAGCATCCACGCCTGCCGAGCATGCTCGGGGAGGTGGCTTCCTCCTTAAGTGGGGAGGTTCTACGGCTGCAAACCAGCAACCTC
CGCAACCAACTGAAACAGCCACAGTATCAGTTGCGATGACGAAAACGAATACCATGTCTATACCAGGAACATACACTATAAAGGAATACGCACAGACCGG
GCCTGCTGCGAACGACAaacaagcacaagctggGCTTGTAGCGAAGCGCATACACGCACAGGCAGGGCCTGTAGCGGAAGACGCAGtcgagctgaacaag
atATTCAGCTCGGAAGCAA