Description :
From Genome Similarity Track
Location :
Scaffold_2609:84- 2295
Sequence
2211 bases(100 bases per row)
CACTTCCTCCTGTGCAAGGTTGCTGTGTGACCCCCGTCACACTTGGTAGCACTCGTAGTCACTTCCAGCACCATCCGCGGGTAGATTGAACCTACCTGAA
CCCTCTGTGCGCTCCATCGTTTGAGCCAAGATGGACCCGAAGCGAGTTTCCCTCGCTTGAACGACTCACAGTACGAGTCTGTTCGGAAGATGGGAGGCAT
CTTTGGACAAGATGTCCTTCGCAGCTTGGCGGCGGCGACGCCTGCCGAGCAACAAGAACGCGTGACCGCGTTTGAGACCTACGAGCGTGATCTCATCGCT
CACGTCCGCGGGAGCTTGGAGGCCACGATGGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTGTGGCTGAAGGTCCCCGCGTTTGAGGGGAAGGAAGGAG
AGAACCTTCACTTCTGGGTCCGTGAGGTGGAGATCGCCATGAAGGCGGGTCTCATCTCGGACGAGTCAGTTCGGGTGGCGTTTGCCCTGTCCAACCTTGG
TGGACGTGCCAAGCACTGGGCGTACACCAGGGAGACGACATCTCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCATCTTCGAGCCGCGTTCCTA
CCGGCGAACAACGAGTTCCGCCAGCGCTCACGCTTTCTCGCGTGTAAGCAAGGCAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACGTTGGTGG
CATCTCTGGCAGGGAATCCTCTGCCTGAAGACATTAAGACAACAGTCTTCATGGACGGCCTGAAGGTCGGTCCTGCTCGCACCCAGCTATTCCGGGTGCA
AGCGACAACTATGGAGGAGGCGATACGAATCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCCTCGGGAAGAGGAACATCGCCACGATGAT
AATGGCGTTCCTCGGGAGGCGGAGCATCGCAGCAATGACGCTATTGCTCCTGCTGTCACGCAGCCCGTTGATACCGGCGCGTACAGCGAGCCCGAACTTA
AGCTCAGCCGAGAGCTTGGTCAGCTGCTATGGATGCGGTGGACAAGGGCACTACCAGCGTGTGTGTCCCTCGCTTGTCCTCGGGAAGAAGACAGCCCGTG
GACCCGAAGTCCGGTGGCGCAGGCCACGGCCAGGTGGACGAAGACGCCCCGGCCACCAGTAGAGGCGGTATGCCCTACGGAAGAGCGCTAAGCCTTCGTG
ATGTGTGTGCAGGTTGTGCGCACCACGGGACTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGCAGTGATGGGCTGCTGGTAGTACACTCGG
TGTACGGGGGTACGGTACCCCTTGAACGTTTGATTAGTTCTGGGGGGTTGATACGCCGTCGGAACGTCGCTTGGCATAGCGACATCCGACTGCACTCTAT
GTCAGAGTGGCGGTCGTGGGCTAGTCCTTGGTGGACTAGCTTTTGGTACGGTGAAGGAAGTACCGATGGTTCTCAACGGACCTGAACGTTTCGGCTCGAT
GAACTCGCGCATCGCGGTGTCGCTCGCAGTTCTCGCCATGAACAACATGGCTGTGCCGAACATAAAGCACAGCCCGGACTTTGGTGTGGCAAGGCTGAGA
AGGGCCTCCCAGTCCAGGTCTATGACGGGAGCATTGGCGAATCAATGTTCCCCACCTCCGTTATGAGTGGAGCGTCTGATACAGACCCGCCAGGACGCAG
AAGCGTCACGGAGCTGTCGACGCGCCGACAGCTCTGCGTACAGCAAGCCCCTGCTCCGCTGTGGCAATGCTACGGGCATGGGTCTTTTGCCCGGCGTGTG
GACCTGCTACACCAGCAGCGTCCAACGCGGAAGTTCGTCGCGCCGTACGGGCTTCGACAGTGCTTATGCCTTTAAGCGCTAACCAGGTGAGTAACTTAGG
ACCACACGGTCGCCCATACCTTAACTGAAGAGGAAGGCGCTGAAAGCGCTTCCTGTATGGATAACACAGTACCACACGCAGTCGCCCAGACTATAACTGA
AGAGGAAGGCATTGTCCATGCTTCCTGTGTGGGTTACCAGTGCCACACGAGGTCTCGAGTGCCTCTGATGTCTTCAACGAGACATCACGACGTGGGGTAA
CAAAGTGCTACGTCACGTCAGCCGCCGCAAGTCGGGTCTGAACCTTGTTCAGGCCGACGTCGCTTCAAGCGACTCGGAGTCCCAGGTCTTGGACTCCTCT
GACTCGGTCGG