Description :
From Genome Similarity Track
Location :
Scaffold_3716:84- 2269
Sequence
2185 bases(100 bases per row)
AGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCC
ACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTT
CGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACC
ATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAACCCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCG
TTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATC
CAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCA
TGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCATACAGACCTTAGGTGGAT
CTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGA
GACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTC
CTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTT
TAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCG
ACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGATTCCAGCATC
CAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTAC
GGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACAG
TCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATC
CGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGTTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTC
GGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCATCTTGGCCCGTAGACCG
GCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACCCCCAATCCACAGTACC
GGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAA
GGTCAAACACTTCTCAGCATCCGACGTTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCC
GTGAACTCCTTCAGATCCGATATGGCTGAAATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAG
TGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGAGGTCCATCTCCACGTCTCGTGCTC