Description :
From Genome Similarity Track
Location :
Scaffold_3698:84- 1830
Sequence
1746 bases(100 bases per row)
ACCTGGATCTGGGCGGGATCCACCCTTTTCAGTGTACACCTGGATCTGGGCGGGATCCACCCTTTCAGTGTACACCTGGATCTGGGCGGGATCCACCCTT
TCAGTGTACACCTGGATCTGGGCGGGATCCACCCTTTCAGTGTACTCCTGGATCTGGGCGGGATCCCGGATCCGGTTGGATCCGCGCCTGGATTTCATCC
GGATCTAGCGCCAATGACCCAGTTTCAATTGGGTCAGTATAGTTTGGGCCCTTGAAAGCTCGCGCTTGAGATCAAGCGGGACTCTTCGCACGTAAAACGT
CACTCTTATGCATAAACATTCACTCATTCCTCCTAATCCACCCTTCCCCTGTGGATCCGTCTTCTCTTTCTTTCCGTGTGACCAACTCACATCAGCGATC
CTCCTCCTCCTGGCCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCAACGAATCCCCTTCCTACTCTTCTTCATG
AGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGTCTCGTCTACCCAACTGGGT
TCGTCATATCCACGCCAATACACTAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCAGTGATCTTCTCGACTTCGAACT
CGTCGTCTTCGAGATCCATATTCCAACTATCTTCCGGTAGGAGGACTTCGTCTAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCG
ATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCA
ATCTTCTCGCTCACCCGGAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCA
CTTGGATTAGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCTTTCACCTGGGATCTAGCTTGCTGGTA
GTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCTTAC
CCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCTCTCTGAT
CCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCGGCGGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTG
TCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAGAGCCTGGCTCCCGATCATGTATAATCATCTCGCTAGCTCCCAATCTTCGATAA
ACGCACTCCTCGTACGATTCAGCAGTGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAATAATT
CTGTGTTTCCTTTGAGCGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGCGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTC
GATTGTGAGCCTGCCCTTGCCTGTCTCACAATCCACACATTCGCCG