Description :
From Genome Similarity Track
Location :
Scaffold_617:84- 1213
Sequence
1129 bases(100 bases per row)
CCCGATCTCCTTCAAGCCTTCCGGCTGGTTCGAAAAACTGGGCGAGGCGTATGAAGGGTTCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCAACCCAT
TTCTTGTGGATCTCCGCTGAGCAACGTAGAAGGATCCTGGATTGAACGCTTTTGCGCGAGAGAGAAGGCAGAGACGATCTCGTACTGGCCCCCGTTGGAA
GAGGGTACTGCAGCTGATCCTTCAATGCATGATCGACAGCCTCTGCGATTTGGACATTTTAATGGACCCCATGTTTCTACACTTTCCCCGTCCGAATGAG
GCTAGGGTGTGCTATCCCGGCCTATCCGTGCGGCGGACCAACATACCCAACTTGATCACTGCCTTGTCGATCGATCACGCTACCGAGCGTTGGAGGAATC
AGTTTCGTCCTTCGATCGCATCCCAGCCTGGGTCGTCTCTTCCACGCTTGGTTGGTAAATTCTTTGACCGCGAATAATTTACTTGGTCTGTTCCATGACG
CGATCTCTCAATATACTTTCCTCTCATTTCCATTCGATCGCTCCCATAATTCGTATTTCTTCCATCCTTTTTTGTCTTTTCATCTTTTCCGCACCATTAA
GTCTGCGATCGTCGCACTCAATTCACATAAATCCCATTCCATCTCCATGTGCAAATTTCTTGCACCCATAACTCTCCTCCCCGTCCATGCACCGTCCCTG
CATAGACCCATCCACTCAAGCTCTCCGATCATCGCTATTCCCTGGCTTCTTCTTCGTGCGATTGCATCACCTCAAAACGATTCTTGCTCACCTGATCGCG
ATCGAACTCCTGCAACATAGCTCCACAATTTAGATCAGCTTCATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTGTACCAGGTACTGCTTGTGTATT
CGGCCATATCTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAAACTCGTCCTATTCGAGATTACCCTCCCAACTATCTTCCGGCTGCA
GTGCTTTCATCAAAATCAAACCGACTCGCCTCATCCACATTCAGCCCACCCGTTGGGCGTTCTGGGAATACGCGAAACTAGCTTCAGCTTACACACGTGG
TACTATTGGGAATAGCGGTACGGCGTGCC