Description :
From Genome Similarity Track
Location :
scaffold_724:8399- 9641
Sequence
1242 bases(100 bases per row)
CAAGAACGTTGTATCGGTCGAGTGCGGATTGGTGGTTCGATGGTGGAGTGGTTTGCGGTGGAAGCGGGTTGCTTAACGGAATCTGCACCCCCATTTCCGC
AATGTCTAGAAGGCAGGGGAGGTGCTCGTAGCCGCTGCATACCCGGGTCAACACGTCTGGAATCATGTTTTTGTTGGGCCTATAGTCTTCGGCAGTTTGC
CCGCGCAAAAGTTCGACGAAGGCTGGTAACAAATCTGTGTTCGCCGTACGTACTCAGAGAGAACAGCCTGAAGGGGCTTGTTGATACTAGGAATGCCACC
TTGCTCAGCGGGCTGCAAGCCTGGGAGCTTGAGGCCTACTGCCTGAAGTGCACGGTTAATGTTGGCGAGGCGGATGGCCTCCCACGCTGCGTGTCGTAAT
TTGGCCTCCGCTGCGTAACGGTGGGTTTCCGTTACAGTAGGTGCCCGCCGTAGTCGAGGATTAAAACGAGAGTCGGAAGTGTATCCATGCCTGAAACACG
TGCGCCGAGACTGATGTACCCTTTGCTGAGACGGGCGGGGTCTGTCGGCGCGGAGAACTTGCATACGGCTTGTCGGGCATGGTGCACGAGGCGCTGGATC
GTCAGCACCATGGGGCGACTGAGCAGAGTTTGCGTTGCCGTGGGGCGAACACGTGACATTGGTGTTGCCATGGGGCGAACGAGTAGAACGGTGAGACGTA
TGGGTCGTGGACATGCCATGGGGCGATGTCACATTAGGTAGATGCTCACTAGCAGAAAGATTTCCAGAAAAATTGTATTTCGGTATGCTGCTGTGTGACC
GAAGTGGCGGTGAGCCTGGCACCCTCACTGACGCGTGTGGCGTGGGCCACGGTACGCGTCGGACCTGTGTTCGTAACGAGGCTTCTGCCGGCTCTCGCGT
CGCTCATCGCTGCGTTGGCCGGAACCGGGGCCATAATGGCGGTCGATGAAGTCCTGTAGATCGCGGGGCAGGCGACGTTCCCATGTGTGCGTGCGCCGAG
CGTGAGCGCAGTGATCGGCACTGCCGCCGTAGCACATGCCGCCACCCAGGTATCGCAGGCAGGGTTCACGACCATCAGCGTCGCGTGGAATTTGTCTGCG
GATAGAGTCCGGCATCACTGGAACCCGGCCAACCGGCGCCTGAACTGGCCTGGAGTCGGCAGTATATGTTGGCTCTGTGTTCGACGGAGCAGGCTGCAAT
GATGTCGAGGCGGATGCGCCGGAGACGCTTGACGTCTGACCG