Description :
From Genome Similarity Track
Location :
Scaffold_2:839578- 841910
Transcript NameFunction/comments
Phyca_LT15344495exocyst complex component 4, putative

Sequence
2332 bases(100 bases per row)
atggaaacaccgccaagcatccgccagcagtatgcgtcaccgccgcgcgagtcaccggaggaacgccggcgcagactaactaaccgacgtgccgcgaagt
accgtcacttccgatctttggctagcgcacagagcgactccaacgctgcaattgagctccagcggcaacagaacacgcgcagacagcgagagcgccgctt
acttctggacgatgaggctcgcgatcgcttacgggcgcaaaaccggcaacggcagcagctccgacgccaaagcctgagtgaacgggcgaaggccgagatc
cgagcaaagcagcgcgttcggcaacgcgaacgccgacagatgctggacaccaacgcactggaggagctacgagagcgcgagcgcctgcgtatccgacggc
ggcgccggcaacaacttaatgaaacacgaagacagcaacagattgaagaggaaacagatctactaccggcacagctacaacttcagttaacgcatcctcc
cgtggccgaccaggaacgccgtcagttaagactggcgccggaactgccaacacttcggcagcaccaggaacagcaaagacagatccaaaacagacttccg
tttgggggcggcgtgcaaatcacactgccaccgccgccgccccggaccttccagcacccgccactacctcatttgcagcaggtgacgaggccgtcgacat
cctcattgttgcattcaacgccaccgccgttatttcctatacctggacctctttccacgtcaaatggaggtccggtaggctccacctcggctgcgttgcc
aactgttgctagcgctgtggccgtcgctgcgacgagaccgccacacccaacgccgatcatgccgtccgtaagtttgccactaccggctaaaccgctgact
gcactgccgatggttcctcaacaacagccaccacgaacaccgattgtgcttccacctgcacatcgttcacttccacctctgccggacttcctcaatagcc
gcgaagcttttaaccccgctactgccgctgctgcagcagcgtcgacacgaacgtcacgtctttcaagtagtgccagtagagcgctgttcccgtctattac
ggatctaccagctacactgacagatgcacaagaagcggattcctatttccaacgatgaaactcagcaaccacttcgaagacgtgcactttgcacttcaga
aactctacggctcaccgcaatagactgtcaagtttgttgacgctgccttttgcgagtgggcgatgcggagcgtttacatgccacagcgctcggaaagctt
cgtgtgcgtaggcgccgcggtttgccaggaggaacatttcaagttgcgtctcggacaagttaaggagttggtagtaccttttggcgtgctccagacgtga
agctgacgaacaagatgaaggcatcgacgccgccgacgacaaggacgcgctgtcgtgagggtacgagtacagagtgcccgtgagtccctgacgaagtgca
ccaatgttgagcagcatttgctggacacctccgcgcgtgaacgtgcagcccgtcatttgcgcaagattaccgatcagcaggcgagacaacagcgcgtcca
ccccattgaacaccagcgtcatcttgtcactcgccaggtacggctgcaacgcattctcgatggatgaaaggttgaggttgagcattagaacgctgtcttg
agccatggtgggctggccttcttccatgtcgaaccgttgcgaaacaagctgcgtcaggtagtagcaacagtggagccggacttcacgacgcaggaagaga
agacattcatcagctagagcgctgcactgccagcttgccgcttgaagtgccatggtaagtgccggcggggtaactaagctgttgttatcggtctcttcgg
aacctcccgcgacacgttgcaggtacagcgctatgagatcacacgcgctgttagcgtagccaagcataccgatgcgcgcgttgtccatgaggagtccatt
ggagccttccatccatgcgtcaggatcgtaaaatccactctcaagctcaaactcccttgccgctatcacctcctctgtactcaccctggagttactaggc
gtcgagccggttggctgcaccttggagtggtgatatggaatcggactgccgtgtttggcccgttggtagccatcgtactcgtgaaaaatggctgcaaggt
ccgcgtacgtgacgcttttcgcctgcaactgcttatggtttagcgtttgctctcgaatgtcgcgcacgattacagcgcattcctccagccagctcagtac
tgaagcttcgaggacgctggccaggccggatg