Description :
From Genome Similarity Track
Location :
scaffold_3:839528- 840541
Transcript NameFunction/comments
Plaha_PHALS_12809hypothetical protein

Sequence
1013 bases(100 bases per row)
ATTCGCGGGTCGTCTTCTTGACTGCAGAACTTAGCGACAAGGAAACTACTGCAAAAATGCTAAAGCTTCAAGTTGAAGAGCTGCATATGCGCATCCAGTC
ACTAGAGAGTGAGTTGGAGGAGCTGCAACACCAGCGTGAAGCGGAGACTGAGGCGGCAGAGAAGACCATTTGCAGCTTAAAGGCTTCAGAATCACAGTCC
AGTGAGGAACTCGAGTCAATACGTCAGGAGGTTGCTGAGCTGGAGGCGCGTCTTGTGTCTACAGAGAAGGAGCGTGAGATTGTCAGCATGACTTTGAGCG
AAATGGAGTCTCAGTGCAATGCTCAAAGCACAGAAATGTTATCCATGCAGACACGTATCCAGTCACTTGAGAGTGAGTTAGAGGAGCTGCTACACCAGCG
TGAAGCGGAGACTGAGACGGCAGAAAAGACTATTTGCAGCTTGAAAGCTTTGGAATCACAGTCCAGTGAGGCACTCGAGGCAATACGTCAGGAGTTTGCT
GAGCTGGAGGCGCGTCTTGTGACTACAGAGAAGGAGCGTGAGACCGTCAGCATGACCTTAAGCGAGACCGAGTCGCACTGCAACGCTCAAGGAATAGAAA
TGTNNNNNNNNNNTATTCATCTGGCCAAGATGTTTAGGATAAAGTCGGACTTGAAGAGCTACGACTACGACGTCAAGGATATCATCATGAGGCAGGTGAT
GCTGGACAGTCTTCCTGACCTGTATGAGTATGAGCAGGTGCGCGGAGCAGTGAAGTATGGGCGTTCTGCGGAGATGACCCCGGATGGACTCCGGGCGTTG
ATTGAACAAGCGGCTGTGAAACAGTCACTTCGCGGCAAGGAAATCGCACCACTAATACAGGTAGTGGCCAACGGCTGCAGCAAGGAGACAGCACAGGTGC
TCGCCATCAACAACAAGATGGGCAAAATGGGAGCAAGAAAAATCAGCACGGTGATGGCCAGCGAAAACCGAAGCGTGACAGGAAGAACAAAATTTGTCAC
CGGTGCAATGAGA