Description :
From Genome Similarity Track
Location :
contig_108:83938- 85426
Transcript NameFunction/comments
g11174.t1hypothetical protein

Sequence
1488 bases(100 bases per row)
GCCACCAGTGCCTCCACTGGTCGACGCACCCGTCGACAAAGAGATCGAGCCACTCGACCCGGAAGACGTAGGTCCAGACGTACCGTGATGCACCGCTGGA
GCTTGTCGCCGCGAGGCCATCGCCAGTGTTCAGCGTGATAGATCCACTGATGCCGCTCGATGCTTTGCCGCTCGCGAACGTCAATGCGCCGCCAGTACTG
CCGCCACCGCCACCGAGGCCAGTTCCCGTGCTGCCGCCGGTACCGCCCGTGATCGACACAGCGCCGCCAGCACTGGCCGCACTGCTCGTCAAGCCGCTCG
AGATCGAGACCGCCACCAACACCAGCCGTGCCGCTGCTATCTCCAGCGCTCACAGTGACTTGTCCACTGGCACCGCCAGAGCTTGTTCTGACACAACTCG
CACTGAACCCGACGCGCCACTAGTAGTGCTACCGGAACTCACCGTCACCAGGCCAGACGAACCACCGGTCGCTGACCGCAACGTCACCTGGCCACTGGTC
GACAGAGACGCCGACGCCGAACCACTCGTGATGTCAACCAATCCACCGACACTGCTAGCAGCGGTAGTCCCACCTGCGGCGACGTTTACATTGCCACCGG
TGCCAACTGTGCCACTGCCAACCGACAGCGAGATCGCGCCACCAGTGCCTCCACTGGTCGACGCACCGTCGACAAAGAGATCGAGCCACTCGACCCGGAA
CGTAGGTCCAGACGCTACCGTGATAGCACCGCTGGAGCTTGTCGCCGCGAGGCCATCGCCAGTGTTCAGCGTGATAGATCCACTGATGCCGCTCGATGCT
TTGCGCTCGCGAACGTCAATGCGCCGCCAGTACTGCCGCCACCGCACCGGAGAGCGCCAGAGCACCACCAGTTCCCGTGCTGCCGCCGGTACCGCCCGTG
ATCGACACAGCGCCGCCAGCACGGCCGCACTGCTCGTAAGCCGCTCGAGATCGAGACCGCACACCAACACCAGCCGTGCGCTGCTATCTCCAGCGCTCAC
AGTGACTTGTCCACTGGCACCGCCAGACTTGTTCCTGACACAACTCGCACTCCCGACGCGCACTAGTAGTGCTACCGGAACTCACCGTCACCAGGCCAGA
CGAACCACCGGTCGCTGACCGCAACGTCACCTGGCCACTGGTCGACAGAGACGCCGACACCGAACCACTCGTGATGTCAACCAATCCACCGACACTGCTA
GCAGCGGTAGTCCACCTGCGGCGACGTTTACATTGCCACCGGCGCCACTGTGCACTGCCAACCGACAGCGAGATCGCGCACCAGTGCCTCCACTGGTCGA
CGCACCCGTCGACAAGAGATCGAGCCACTCGACCCGGAAGACGTAGGTCCAGACGTACCGTGTAGCACCGCTGGAGCTTGTCGCCGCGAGGCCATCGCCA
GTTCAGCGTGATAGATCCACTGATCCGCTCGATGCTTTGCCGCTCGCGAACGTCAATGCGCCGCCAGTACTGCCGCCACCGCCACCGG