Description :
From Genome Similarity Track
Location :
Scaffold_927:8393- 12422
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_927-fgenesh-gene-0.3Kinesin
Pytir_DAOMBR486maker-pir_contig_927-snap-gene-0.6Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_927-snap-gene-0.7Conserved gene of unknown function

Sequence
4029 bases(100 bases per row)
GCAGCTGCTGTTGTGAGCCCTCGAGCGCCACCACACGCCGGTTCTGCGCGTCACTGTCCTGGATCAGCTGTGCGACCTGGGTCGTGAGCAGCGACACAAC
GTTCTCCATCGCGCTCTCCTGCGCGACGAACATGCCCGCGAGCTCCGGCAGCAGGTCCTCGAGCTTGCTCATGATGGACGGACGCTTGGCTCGCCTGTTA
TACAGACCTGGTTGGCGGTGGATCTCTCACCAGGCTCAGTCATGGAGTGTGTGGTGCATGCACCATTTTTCCGTTACATACAAGAAGACCATGAAACGAC
TGAGCGTTAGAGGTGCTGCACAACTGCTACCTGCGGTATGGTGGTAGGAAAGATGAACGCTTTTTCTTGGTATATCAAACATACAGCGAGTGATAGGCAT
CTACCTCACCATTGAGCCAATTGCATTCAGGCGGTGGTGCGGCGTGGTGGCGGGCTGGACGATGCAGACAACCAACAGAAAATGTATCCATGCTGCAGCA
CGAAATCCAGCGAGAATAATGTCACAGAACAAGAATTCATTCCACTTTAGGAATGGCATAATCACCTCCAGTGCTGCGAGAGGAAAGGGCTCCACTTAAC
TATTGCACTATTGAATCTACCCTCTCAAATTGCATATTTAGTTAGTGTCCGCCTCATTTCGCTGTGAACCCATGTTTCACCATCCACACAATCATTCCTT
ACATACACTTCGATCAAATAAAACCTCACAAAAGCAGCAATAACTGCATTAAACCTCAATCAAGAAAATCGACAGCGCAAGTCAAGCCATTCGGCGACCA
GCGTCCAGCAGCTCAGAGCAGCATGCACGGCGGGCAGTACGCGTACGACGCGGCTGAGAAGCCCCCGCCGGCGCCGCTCTACCGCGCCGACAGCCAGCGC
CAGGAAGCGTCCGCCAGCGCACTGCCGCTGTCGAACGAGCAGCACCNNNNNNNNNNNNNCCGCAGTACCCGACACTCCCACCTCGGGCTCCTTCTCAATA
CCAGCAGCAGCAGCAGCAGCAGCAGCAGCACTCGTCCTATGGCAACCAGGCTCTGCCAGATAATTACGCTCATGGATCACTGCGCCACCAGCAGTCCCAG
CCCCCGCCGATGTACGCACAGCCGCAGCAGCAGCCGCTGCTGCCCCAGTACGCCAACCAAGGGTATCCGCCAGCGAACGGCGTGGCGTTTGGTCCAGTGA
TCAGAAGAAGACCGCAGCGCGTGCTAAAGCACCAGTTCCTCAAGCGAATGCTGAAACTTGTTGGCTTTCATGCGATGAACGCGGTGCTCGGCTTTGTCGC
GTGCTCGCTGTTGATGGGCGGCGTGAGCTCGTCCTTCTCGCTGATTCCGCTCTGCTGCTTCGGGGTCGTCGTGTTCCGCATCGTGCTGTACGGAGTGCAA
GTCCTGGCGCAGTTTGATGTCATGCTCTACAACTTCATCTCGCTTCCGCACGAGAAAGTGTACCTCGAGAAACCGCTGGAACGTGGTGTCTCCGGTCTGG
TGCTCGCCCCCAGTCTCGAGTGCTTCTCGCCGTTGTCGATCCTGGCGCTGCTCTACTTCCTGTCGATCAAGTTTGTCGTCGCGACACTGAGCGCTTTGAC
AGCAGTAATGACTGTGTGTCCGCTTGTGGCCATCATTTCGTCAGCATGTGGCGCTGGGAAAATTGACATCCAGGTCGGAGCCAGCAAGTACTCGTACCAC
AACGACACGACCGCGTTCCTGGTCGTCGCCATTTGCATCACCGTCATTGGCGGCGCGCTGATGATTTGCGCCGCCAACGTGTCGAAGAAAGCCACCAAGT
TCTTCTGCTGCGAGCCGTTCTCGAACTATGCGTCGTTGGCACCGCCAGGATACCAACAGCAGGCGCGAGACCAACTACCGTCGCAACAATTCACAATCAC
CTCGTACGTCTCCTACGGCTCGGCGTAAAAGAAAAAAAGACTTGTATGGTTTTTGAAAAAGAGGGAGAGAAGAAAGTTGGAGAAGCTAAGAACTATCCTA
TCAAGGATATGCAGTGATTGCTTGATAATCAAGCCAAGAGCCATGAATATTCCGTGTTGTAGCAATACAAAGCGCATACCAAAGGTAGCATTGCCGTGTC
ATCTGCTCTCACAAAGCCAAGCTCACAAAGCCCAGCGATCTTTGGCTCAAAGCCAGCCCACACGATTCTCAGAGACAGAGGGCTCTTTTCTGTATGACGC
ATCACCATCATTCCTGAACAGGAATGAATGCTCACCATCACTCTGGCACGAACAGCTCCATCACCTCTGCTGTGTGAAACGAATGGCAGGTTGACTGGAG
TCTGCAACAGTTTGCAACGCGATCCTCACTTCTCAAACGCCTCGCACCAGAGCACCACCATGTATCCGAATCGCCAGAACTCTGCCGATAACAGCGGCCA
GAACTACGCACGCAGGGAGTACACGGACAGCGAGAAGCAGCCGAGTGGCTACGACGACGTCAGCNNNNNNNNNNNNNNNNNNNTACCCGTCGTTCCCAAG
CCAGCAGCAACAGCACCAGCACCAGCCGACCGCTCCCTACTACGACAATAACACACAAGCTCAAGCGCAAGCGCTGCCGGTGTACTACAACCACGATACT
GCTGCTCCGCAACAGAATGCGCAGTACCGCTACCCGACGCAGCTGCCAATGCCAGCGTACCAGCTGCAGTACGTGTCGCCGACCCACAGTGGTGACTACC
GCGGTCACAGCTGCATCGGCACGACGCTCAAGCTGGTGATCTTCCACTTTTCCAACGCGATCTTGGGCATCACTGGATTCGTGTTGATCATCGCGGGGGT
CAACATCTCCATCGGTCTCCTTCCGCTGTGCTGCATTGGTATTGTGCTCTTCCGTGGAGTGCTCTGGATCGTGGGCGGACTCGCCAAGCTCGATGTGAAG
CTCTACAACTATATATCTCCGCCAAGTGAGCACGTGTACGTGGACATTTCACAAGAGATGCGGTTCCTTGGAGTCGCGGGCGAGCGTCTGTCGCCCAAGC
TGTTCTCGTTCTCGCCGCTCGCCATCACCGCGGCGCTGTACTTCACCACCATCAAGTTTGCCCTCGGGCTTTTGAGCACTGTCGCCGTGTCTCTGAACGT
GGGGCTGCTGGGAGCGCTGGTGGCGGCGCTATCTGACAATGACGTCATGGACGACCACTATGGGCTCCAGTTCGGCAGCCGCAGCATTGACGCCCGTGAG
AACCTGCTGCTGTTCGCGGTCGTCTGGGTGTGCATGTTCGTGATCAGCATCGCGCTCATGCACCTCGTCGCCAAGGTGTCGCGCGCGTCAACGCGCTTCT
TCTGCTGCGAGAAGTTCTCCACCTACCGCTACGTCAACACGGTGCAGTACGCGCACCCAGTGGCGCAGGTGCCAGTGAATGCGAGCTACGGGACGTACTG
ATTGATATTGTCAAAAGGAGGCTGAGAAGAAACGAAATGACAAGCTCCAGAATGGAATGGTGCTTTTGAAATCGTTGTAGCGTTTGTTTGGTATTGGCCC
TATGGATTGAGAGATTGGAAACGTGAGAATGATTCTGAGAGCTACATGATGTGAAAGATTGAGCGAGTGCACGCCGATAGCTCAGCTGTCATGTGGCCAG
CTGCAAATGAGATTTGATGTGAAGCAGGTTTGAGTGGGTACAGTACACCCGCCTGTCATCAAGATTCACCCTTTATAATCGATGATTGTTTCCTATGATG
TTATTCAAATAACTACGGAGGGTATTTCAACACTAATTATATATGATAGCGTGAGAAAAGTGCTGTGGTTTCTTGGCAGGTGATTGAATCATTGAGTACC
ATCATTCCCATTTCAAAATGGTCGTTCCAGAAAAAGAACGTGGAGGACCCTTGTCTCCGCAATAGTGATCTATACAAATCCTTATACAAACCACTTTAGT
GACGTTGTTGATTCAAGTGATGAGCAAAGTGAGCTGGATGAACCAAGCAGTTGCAAAAGTGATTTTTCATTCTCACTCGCCCCCAACGAAGCTGCTCGCT
CGCCATTCTCCAGCAGCCTCAGCAGCGCG