Description :
From Genome Similarity Track
Location :
Scaffold_456:8393- 10040
Transcript NameFunction/comments
Phyag_g5860hypothetical protein

Sequence
1647 bases(100 bases per row)
CGATTGTGGCAAGCATGGTGAATGCCGATCCATGAAGCTTAATGCCATACGCAAGGACAAAGGACTACCGCCCCCGGTGGTTTACGGAGCGATTTGGGAT
AGCGAAATGGTTCATGGCTGCGTTTGCGAAGAAGGATTCGGAGGAGGCGATTGTTCTGATCGTGAGAACTATTCGTCTTTCGATGAACTATCTGCTGCTT
ACGCATAACCATTCTTTGATTTTTTGCCAGGTTTGTGTCCTACCGGTGATGATCCACTTACTGGGGCATCTACGGATACGTTGTTTGGATTtcagaagaa
cgagaagcaaaCTGTTTTTTGCGTAGCTACGGTGCGTACCCTGGTGATTGTGGCGTTGTTGCTTTTTATTCTCTATCGTGTTGATCCGTTTTGCAAATGA
ATGCCACTATAGAGCGGAACGTTAACTTTAACGTATCGGGGGCAAACGACAGTCCGTATTGATGCTTTAGACAACGCTGATGTAGTGAGAAGGAAACTCA
TGGTACGTATTATTTTCATGTCTTCGGAAGAGAAAAGATGTTCTTCAATTTTGACGGCTTTTGTAACTTAGGCACTCCACACGATGCAAACCATAAATGT
ACTTTTCGCCGGTGTCATCACAACCATGTGCACCGCGGACGGCAACATGGCCACTGTTGAGTTCCTGCAAGACTTTGGGCCGTACGTTTTCCTCATACTC
TTATTTGTAATCCGACTAGCAGCCTTACTGGATCCATTTTTTTGTTCGATGTATAGATTGCCTCTGTTGGTTGGAGATTCATCTCTGCTAGTGTACGCAG
GTATCGGCAGCACACCACAACTGACAATCTCGAAATCTGAGGTTGGATCCAAGGAAAATGAAGCATGTTCTAACCGCGGTCACTGCGATTTGACCTCGGG
TGTTTGTACCTGCTACGTGGGCTACACCACCAGTGACGGAGAGGGTAACCCAGGCGATCGTGGCGACTGCGGAGCCACCAACTCCGCCGTCATCGCATGT
CCGGTACGTACGTTCATCAACAATCACCCAGAATATGCACTTCTCTAATGATGACGTCGGACCCAGGGCGACACTGAATGTAGTGGCCACGGGTATTGTT
CGGGGGCGCCTCAGTTTCGTTGCTTCTGTGTGGCAGGATATACATCGGGAGATTGCTCTGTCCGAACGTGCCCACAAGGGATTGCTTGGTTCGACACGCC
CATAGCCGACAACCGCGCCCACTCGATGGCGGTGTGTTCAGGAATTGGTGATTGCGATGGTTCGCTTGGTGAGTGCACATGTCCGGCGCCATTTGAGGGT
GCTGCGTGTGAGCGGCTTACGTGTCCTCCAGGTTCAGACCCTGTCTGCAACGGGCACGGTCGGTGTCTCACAATGGCTGAGCTAGCACTGGAAGCTCGCA
CTCCACTCGGCGATCCGCTGAGTATCACGTACGGTAGCACACCAAACAATCCGCGAACCTGGGATTTCAACAAGATCGAGGGCTGTATTTGCGACGACGG
ATTCGAGGGACACGACTGTGCACGACGCTCTTGTCCGCGCGGCGATGACCCACGAACAACAGGCCAGAGTCGTGAGGTCCAGACAATTCGTTGTGTATAC
ACAGCGTTAGGGACATTCACGCTCAGCTTCCGTGGGGTGGTGTCGCC