Description :
From Genome Similarity Track
Location :
Scaffold_7:83925- 85554
Sequence
1629 bases(100 bases per row)
CTTGTTACACCTGGTAGCACTTTGTAGTCCGTCCAAGGACCACAAAACCCGTTCAACATGAACATGTTGGACGACGAAGGCGACGACACCTTTCACGGTA
CCCGTGAGAGTTACTCATATTTGAGCGATGTCGAATGGAGTGCGGTCGAACGAATGATTTCGACCGTCGGCGAAGAAGCTGTCTAGTCTCTGCAATCCTC
AAGGGATAGAGACCAACATCATTCCATAGTCGCCAAGTTCTTGCAACGAGAATTTGACGCGTCGCGAGCTGAAGTGACCCTGCTGCATCAGCACGGTCAC
CAGCAGACTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGAGAATCTAAAGTAGAAGTCTCCAAGTA
CCGGGGAGTCGAGGAAGACTACCTGTTGAGATGGTTCCTCGAAGTGGACGATGCCATTAAGGCTCGCCACATCGACGATGAGGAAATGCAAGTTGCATTT
GCCAAATCGAATTTGTCAGGAGGTGCCAGCACTAGGACCCTAAATCTTCAATTACACGATCCAAACACGTTTGCATCGTTGGCGGTCTTTAAGGCTCTGC
TCAGCCAAACATTTGAGCCGCCAAGAGCTGAGTCCAGGACTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACTTTCAGCA
CGTTCGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTGAGTGACTTCGTGTTGACCACGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGAAA
CACCTATTCCGCATCGAGTTGAAGTCGCTTGAGGAAGCGATAACAACTGTGGTACAAGAGGACTATAGTGTGAGACAGGCTAGCACTAGCTTGACCCCCA
ATCGTACTTCGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGTAGTGTCGAGAGCGAGAGACCTCGCTCTTCAAGCAGTAAGCAATTGCA
AAAGTGCAATCGCTGTCAGAAGTTAGTACATTACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTCGTAGCACTGAGCGAAGGGATCGACCGTCTGCC
AAGAAGGGCAACAGACGCGGGTCCGACGCTGTTGCGAAGTCACAACGCGTAGCGGACCGTAAAAACGGTCGGGGTCAGTAGGGGTGGAGCGCCCTACTGA
TCCAGCAACCTCAATAGAATTTGCAAACCTATTGATGAAAGTTGCTCCAGAATCACAATCCTTGTGTTTATCTGCACTTGGTGATGAGGGGTACCTCATC
ACCTTGAAATTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCGTCGACCAACTTTGTTCGTCGCCAGTCTCTAGAGGATCGTA
GGTTTAAGTTCGTTGAGCGCGTTACTCTTCCTACGAGGCTGACAGTGCGCCTCGCAACAGGCGCATCGATAGCAGTGATGAAACGTGTAGTGGGATTTCA
CCACACGTTAGAAGATTTGCAGTACAATGATGGTTTCATCGTACTTGGTTTGGATGATAAATTTGATGTCATCCTAGGGTTACCCTGGATCAGAAGGTAC
GAGCCAAGGGTCAGCTGGCAGCATCGAAC