Description :
From Genome Similarity Track
Location :
contig_87:83917- 85573
Transcript NameFunction/comments
g10508.t1mitochondrial translation elongation factor Tu
g10509.t1conserved hypothetical protein

Sequence
1656 bases(100 bases per row)
GAACGTAGGCACGATCGGGCACGTGGACCACGGCAAGACGACGCTCACGGCCGCCATCACCAAGGTGCTGTCCGAGACTGGCGGCGCCGAGTTCACGAGC
TACGCCGACATTGACAAGGCTCCCGAGGAGCGCGCGCGTGGTATCACCATCTCCACGGCCCACGTAGAGTACGAGACGGACAAGCGCCACTACGCGCACG
TGGACTGCCCGGGCCACGCCGACTACGTCAAGAACATGATCACGGGCGCGGCCCAGATGGACGGCGGCATCCTCGTGGTCTCGGCCGGCGACGGCCCGAT
GCCGCAGACCCGCGAGCACATTCTGCTGGCCCGCCAGGTGGGCGTGCCGGCCCTTGTGGTCTTCATGAACAAGGTGGACCAGGTGGACGACGAGGAGCTG
CTGGAGCTCGTGGAGATGGAGATCCGCGAGCTGCTCGAGGCCTACGACTTCCCGGCCGACGACATCCCCGTCGTGCAGGGCTCGGCCCTGGCTGCCGTGG
AAGGCCGCGACCATACCATTGGCCGCGACGCCGTCCTTAAGCTCATGGACGAGGTGGACGCTTACATCCCGGACCCGGTCCGTGACTTCGAGAAGCCCTT
CCTCATGCCCGTGGAGGACGTGTTCTCCATCTCGGGCCGTGGTACCGTCGTGTCGGGCCGCGTCGAGCAGGGCGTGATTAACACCGGCGACGAGGTGGAG
CTCGTGGGCCTCAAGGCTAGCTCCAAGACCACGTGCACGGGCGTCGAGATGTTCAAGAAGTCGCTGGACCGCGGCCAGGCCGGCGACAACGTCGGCCTGC
TGCTGCGCGGCCTCAAGCGTGACGAGGTGCTGCGTGGCCAGGTGCTGTGCAAGCCCGGCACCATCAACCCGCACACCAAGTTCGAGGCTGAGGTGTACGT
GCTCAAGAAGGAGGAGGGTGGCCGCCACACGCCGTTCTTCAGCAACTACCGGCCGCAGTTCTTTTCCGTACCGCCGACGTGACGGGCGACATCCAGCTCA
AGGCCGGCACGGAGATGGTCATGCCTGGCGACAACACGGCCATCGACATTGAGCTCATCCACCCCATCGCGCTGGACAACGGCATGAAGTTCAGCATCCG
CGAGGGCGGCCGCACCATCGGCGCTGGCGTCGTGTCCAAGGTCGAGTCGTAGATATTTTCTGCAGAACGACTGCAGTAGATGCGTGGGAGCGAAGCAGAC
GTCGGCGTCGTGTCGAGCTTCGTATACCAACAATACATACAATCACTAACACGCAGTGCCGCGTCAACGTTTGATCCTTGTGCCATGATTTCAAAGCTTC
ATGCATCCAATGTTATGCCGTTGCTGTCTATATTTCCAATAACTGTCCTCTGACGTCTCATTTAGTCAAGCTCGTCGACGCTAAAGAATTTCTGATCCCG
TGGTGCTGAGGTGTCATCGGTAGTGTAGCTCCTCGAAAACTGGCGATCGGGTTTGTCCTGACTTGGAGGAGGCATCGAGCCGCCCGGGTTGAAACCTTTC
GTGTAGCTATTCGTTCGTCGCGAGTTGCTTGCTGCCGCCGAGTCGCTGTTCTCTGAAAACTGCGGCGGGTTGAGGTGGCCGGTCTCCCGCAAAATGCCGG
AGAAGTAGTCGAGCTCTTCCTGGTTCCACTGCAGCTCCTTGGAGTTCGCGACGCTC