Description :
From Genome Similarity Track
Location :
Scaffold_141:839- 3781
Sequence
2942 bases(100 bases per row)
TCCTTCTTCACCAGTGGAGAGTCGCGATCGCATCAGCAGTTTTGCGAACCCCACTCCACCACAACTTGACCCAGTACTCCATATATTTGGCTCTACTTGC
TTGACAAACCATATTTTTGTAAGCTTCATGGCATCGGAACAATTGGCTTGACATCATTAGAGCTCTTACACCAAAAGATGCTATACAGCACGAGCTCAAG
ATCTCCTTTCACGATGTCCTTTCAAGATCTCACGCACATCACCTTGCTTGTGTTAATTATATCTAGGTTATAGAGCTGTTTTAATGATGAAGACGGCTTA
CGGCCTTGGATGAAAACCGAAAAGTGAGTTGTATTCAAATAGTTCTTTATCTCGAAACGAATGGCCATTAGAAGCCGGTGACTCTCAGCCACCGATTTCG
TGCCCTGTCTCCACCACGGGTAATTACTTCCTGTAATATTCCTACAGTAAAAACTCTACTACATCCTACAGACGTAGCCGCAACATCACTCTTCAACACT
CTCCCTTGATGTGCGTGCAAAGTGTGCATCCTACACTGCCATGCCCAGACCCTTAATGAACTTGATGTACTTGTCTCTTGGGAGTGCCTTGGTAAATCCG
TCCGTGACCATTTCTTCTGCTGGCTTGAACTCGAGCGCGATCACTGCACTTGCAACCTTTTCACGCAGAAAGTGAAACTTGATGTCGATGTGCTTCGTGC
GCGAATGATAAACAGGATTATTGGCCAACGCGACGCACCCTTGATTTTCTTGAAACATCGTCGTCGCTATCTCGGCACAATACTTCAGGCCCTTGAGCAG
AAATCGAAGCCAAATCGCTTCCTGCGTCGCGCTGTACAGACTCATGTATTCTGCCTCAGTGCTTGAGGTCACGACCGTTGGCTGGCGCTTAGATTTCCAC
GATATCGCGCTCCCGTTCAGGAAGAAAACGTATCCTGTTGTCGATCGCCGCGTATCAAGGTCACCGGCCCAGTTAGAATCCGCGAATCCAATAAGCTCTC
CCTTGCTGAATCCGCGAATCCAATAAGCTCTCCCTTGCTGAATCCGCTAAACACGATGCTCATGTCTTGGGTCGTCTTCAAATACTTGAGAATTCTCTTT
GCCGCTGTCCAGTGAGATTTGTTGTAGCGCTCGCAAAATTTCGCAACTTCACCAACCGCATGCGCGATGTCCGGTCGCGTACATGTTGCGATGTACATCA
AAGCGCCCAATAGCTCACGGTACGGGTACTTGGGTGCAAACGCTTCTGCTTCACGCATCTTCATCAGCTTAGAGTTGCTGGCCGCCGGAGTGTGCATGTC
CTTGCAGTTCTCAACGCCGAACTTCTCTGAAAGTCGCTTGATGTACGCCTTCTGATTCATCTTGATAACGCGATCTTCACGTTTGCGATGAATCTAGATC
CCGAGGCAGTACTTGAGATCATAAATTTTCTATCCGTTGATTGCTTGATCGAACACTGTTGACAAGCAACTATTATCATTGCCCCGTAATATGGACCTTC
TATAATAGATCATCACTTGGCTGTGTCAGTCGAGAAGACTGAATATGTCGTGGACGTATCATGATTGACTGCCAATTTAGTTTACGACACGTTCGATCAT
ATCGTGAAAGCGAAGGTGCGTGTTAGTCACAAGAATGCACCATGTCCGTATTTTTGCTTAATACACCGTGAGGTCATTACAATTATTTCATGCCTGTGTC
GGCGTTGTTCTGAGCGTCACGCGCTGCCGTTTAATGTCTTCGCCTTACGTCAAAACCATCAACGAGAATCAGCAGTAGTCGGCGAGCGATTTTTAGAAAC
CTGAAAGATCCCCCCGTACTTTCGTAATGAAGTAATTGGGTGTTGTGTCCGCTTATAACTATGGAAACGAAAGTTGCGGTGCTTCACAAATACAACAACC
AAAGATTACATATCTTAGTCGATGGTCTGACTGCATGATCGTGAGCTGACGTTAGCTCTGCTGGTGATTCTTTAAGAATAAGCGTCGGCACCTCCACACT
TTCCTCATCTTCGATGACATCGAAGACTCTCGTGTCTTTGTTCTTCGATACTTTCGAGACGGGATGCTCAACGAACATCACGCTTCTTGAAATCACTATC
GAGCCGTCGTCAGCGCTAAGAAGCCGATACGCCTTTTGGTCCTTGGCGTAGCCAAGAAAGAAATATCTTACGCCCGAGTCGTCCAGCTTCTGTCTCTTCT
CCTTTGCCACGTGCGCATAGCATTGCGCACCAAACACGCGCATGTGCTCGATACGCGGAGCCTTCTTGAGCACGATCTCGAACCGGCTCGAGTTCTTGGA
CGACGCATTCGGCAAAGCATTCTGAATGTCTGCTGCTGTCATTAGTGCCTCGCACCAGTAAGACTTATCGAGGCCACTGTCCTTGAGTATGCAGCGTGTC
ATTTCCACCAGCGTGCGATTCATACGCTCTGCCATTCCGTTCTGCTCAGGGTTGTATGGAACCGTGAACTCTTTCTTGATGAACTTTGCCTTGCAAAAGT
TTTGCATTTCCGAGTTCCGGTACTCCCGCCGTTGTCGCTCTGCAGCACCTTGACCATTGTTCCGGAAGTAGTCTTGATCTCTTGGTAGAACCGCTTGAAG
GCACTCGCAACTTCGCTCTTCTTTTGCAACAGATAGACCGTCACTATTCGGCTCTTCATCATGATGAAACTCACGATATACTTAAAGCCGGACTTAGACG
ATAGCGTGATCGGTCCGAGTACGTCAGAGCACACCACCACGTCCGAACGCGAACTCTCCCTAGTTTTAGCATCTTTCTCGATTGTCTTGAATGACTTGCG
CACTTGCTTTGACGTTGCTCATACGTCACACACACTGTTCGACTTTATCTTCGTGTCCTTGATTCTTCCGTCCTTGACCATAGCGTTCAATGTGTCATAC
GACGCGTGACCCAGTCTTCGGTGCCATAGCTCGGTCGTGTCT