Description :
From Genome Similarity Track
Location :
Scaffold_3064:839- 2979
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3064-fgenesh-gene-0.0Alpha mannosyltransferase

Sequence
2140 bases(100 bases per row)
GGATGCCACGAGAAGAGCTCATGGAACAGCGTCACGTTCCCAATCACAGGCTCGCTCAGCATAGCCTCGTACTGCTCAACTGACTGGTGCACCTCCATCA
CGCGCTCCGCACACTTTTTCAGCGTCGCAAATCTCCCACAGTCGATGAAGCTCCTGGGGTTGAACAGCTGAGATACCGAGTCCGAGTGACCCAAGTAGAT
CGGAATGCTCCCCGCGAGAAACGCGTTCACGATCTTCTCCGTCACGTACCCAGGCTGTTGCTGGGAATTCTCGAACGCGATCACGAACTTGTAATCGGTG
TAGATACTGACCGCTTTCTCGTTGTAGAGTGGGCTGAGGCGTCCCGAGAGACGGTCACGCAGCATCCCACGCGCTGAGCCCTGGCACATTCCCAGCGCGT
CGACCGACTCCATGGCGTTGAGCAAGTCAAACATGTACTCGCGCTGCGGCTGGTCACAGCGTGCGTACATGTAGGCGCAAAACTTGCGAGGGAATGTCGA
CGGCGATGGCTGATTTGGCTTTGAGAGCAGCAGCATCGGACTCTGGATCACGCGCTCGCTGAAGGACATGCTTGCCATGGACAGGTACACATGCTTCTTC
CTGGCGACATGGGCCACACTCGAGAGCAAAACCACCCGCTCGTCCAGTGCGCTGACAGCCCAGGACTCACTAGCGACCATTATCAGCGACGACTTGTCTC
CATACTGCTGGACGTACTTGGCTGCTGCTTGCTGACAGTCTGGATCCCACGCAGAGCCACAGAGTCCGCCATCCAACGCCGAGAACAAAAACACGTCTGG
GCTCAAAGCGCGTCTCTGAGCTTGTTGTTGCTCTTGGAACGTGAGCTCGTCGACCACTCGAATTGGGTTGTGCTTGTATATCGAGATGAGAAGACATTCG
ATCATGGACTTGACCGGCTTTGCTTCGCGTGAGTACACCACTGTGATCGGTGGCACTTGTGGCTGCGCTCCGACAAACCGGAGGTTGTGAATCCAGAGCG
CGAGGTGCGCTGAGTCAATTGTTCGATCAGGGTTGCCACTGCTCACGACTTCCAGCATGTGTTGTCGCAGCCCATTGGCGAAAGCTGCACACGCAAAGCC
CGCTGGGAAAACGTGCTGCTTGATCCGTAGACAGAGGTTCGGAAGGAGATCGTCGAGCAGGTCGGTCGCTGGTAAATAGCTGAACGCCCACCAGTCAGAG
CCTGCGGAGGTCGACGTGACGTTCACAAAGACCTGCGTATGTCTGTTATCGCCACTGCGCTGGACGAAAGTTGAGAATCGCACGCCTGTCTTGAATGCAG
AGCTGCCGTCGGACGACGCCTTGCGCCACGTATTGCGATCAAAATCGGCGCAGAACGGTCTCTTCGCCTTGAGATTCGCGTGTGCGATGCGCATCGCACT
CGGGGACAGGTCTGCATACGAGACGAGACTTTCTCGACACGAGCCCGAGTCCACGTTGCTAAACTCGACGACATTGCGCGGATGCACTTGCATCGTGAGC
AGCCAGAGCGCGATCGATGCGTCGTCTAGCCCTCCAAGTCCTTTGAGGCGGTGGCGATTCCTCCCGATGAAGCGCGCGCAGTCAGCTGAGACCACGAAGT
TGCATCCGTGAGTGAACGGCGGCAACTCTGGCAGAGGGTACTGGTCCACTGACAGGTAGTTTTTGTGGCCTGGGTCGCGCTCTGGCGGGACCAGGTTCCC
ATCTTCACCGTACATGATGTGGCCAGCATAGAGACGTTCTGGTGGCCACCTATGTGAAAGGATCAAGTCGATCAGGTCGTGTGTGCGCACGTAGGCGTCG
TCGTCGGTGATCATGATGTACGGTGCCGACGGGAACTTGGTTGTTGCGAAGTGCATAAACTCCTTGACTTTGTCCGTCAAGAGGTAGTACGAGTCGTCGC
AGTCGAGTTCGTTTGTGAGCAGATCCTGGAATATGCGCTTCTCAGTCTCAATTGCGAGCTTGAGCTCTTCGTTTGGAGGCGAGACGACACCGTATTTTGA
GCCAAGCATGGATCGGCAGCCGAGGAAGAAGACCTGAACGGATCGGTGACGAGATGCATTAGCTGCCCATGAGTCACGAATCGACTGGCGCTGGGCAAAT
CCGTGAATGACGCTCGACTTGACCCCGATCACGACCAGAG