Description :
From Genome Similarity Track
Location :
Scaffold_1189:8389- 12072
Transcript NameFunction/comments
Phypl_g12706hypothetical protein

Sequence
3683 bases(100 bases per row)
GTACTTGGGGCGGTCGACTGCTGGCCCGAGCGGGGCCTGCAGAGGCTCCGCCTTCGCGGATCCGGCCTCGATGGTGGCCTGCAGAGCGAGGTTCTGTCAC
TCCATATAGCGGCGAGATCCCACCGACACGAAGCCTGGAAGCCTTGGTACGCGATCTCCTGCCAGCCCCATGCCAACTCTCTCATCGCTTTGCAGGATCA
ACTTCTTTTCACTGAGGTTGGTGGTCTGCATGTACCGTGTTCTGCCAGGCCCCTTGATCAGCGTCGGGATCCAGCGGTCTCCGCGAGTAACCCACAACTT
GTCTTGTCCCGATGCCTTCAGGCGCAGCGATAGCTCCACGGATTCCCCGATCTGGATCTGCATGTGCTGACCCAGCCTCAAGAGTTTCGCCTTGTCATtg
tggagctgtcgccgtccGCTGAGCTGGATCTTGACCTCGTCGGGCAAGGAGATGGATCCATCCGCGAGATCCAGCCGGATTCTCGCCGGAACCATGAAGT
CCATACCCAGTATGGCTTCCTGACCCGATAGCTCGCCCACCCAGGTATCGAAGAAATACACCAGCGATCCTGCTAAGGTAACCTTGATCCCAGTTCTTCC
TTCCGTCGAATACACGTTCTCACCAATCCCAACACATTCTTAGCTCTGACTCCTGTCGACATAGCATCCAACCTTACGAGCAAAGGTAGTGTCCACGATG
GACACTTCGGCGCCGGTATCTAAGCGTAAGACCGCCTTCCCATTGTTGATCTTGCCGGTGATCTTGGCCTGTCGAAACCACTTACCCGATGCATGATGTT
TCCAATACCCTCGCGACTCTCCTGGCAGGAGATCTGAAGatactgcagcaccaggttgGCGATATTTGTCGACTCGACGAAGATCTGGTGTGATCTCGCC
TTCCGTTAGCCTAAACTATTGATCTGGATCTTACTGCTTCCAGTAGCCCTGGCGGGCGACTGGATCAAGATCCACGACCACTGCACTGTCGGATCGAGAG
AAGTCATCGGCTTGATAAATACTCGAGATCACAGCAGTACGTTTCCCAAGCAGTTCACATGTATTACCGCGTAGATCTGGTAGCTTGCTAACTTGGTCTA
ACGGCGTCTTGTTCATGAATGCAAAGATGCAATACCTAGAACGCTCGGCTCGTATCGGATTCCAACCCGACGAGCGTCCTAGTTTAACATCTTCTCAGCA
ATAGCAGGCAACATGCCCGCGTGCTTCGTTGGATTGTACCATTGACGGATCTGGTTGTAAAACTCTTCCGTCGGGCATTTCCCCATGTGGTGAAGTTCTC
CACATCCGCGGCACACGGAGAGGCAGTGATCGGCCGGATGGCCTCTCTTGCCGCACTTCTCGCACGTCAAGCGCCTCCAACATCGGAGATCCGTGTGTTT
ACGGGATCCGCAATGCGTACAGCGGCTACGATCAGGTCCATCAGGTTGGTTCCGAGGACGGTGATCGCGCGGAGCTTGATCCGTCGCGTGCAGGTCCCCT
TGGTTCCGATCCCCGCTGTTCGTGTTTTCTCGAGCTTGCAGTGCATGATCGTTGCTACCAGCGACGTAGACCCGGCGGTACTCGTCACTGTCTGAGTCCG
ATCCGTCCGAGTTGGAGTCGGATTCCGACTCTGTCGCCTGAGTTCGGATCGCGCGAACATGTTTGGCCGGGGtcgtcggtgctggcgttggcgatTTCTG
TCGGTACTTGTTGGATCCATacgcggccttcttctggtgATTCTTGGCGCGTTCGAGCGCTCGAAggacttcttcgagctcgtctGCATCTGGGAGTCGT
TGCAGTGTCAGGCGATCCGCCAGATCTTGGTCGCCCAGCGTCTCGATAAAATTATCGACATGTTCACGTCGCTCTTTTGATCCGCCGTCCTTGATCTTCA
GGCGCGCCCGTAATCCAGCCACGTTAAGCCGATAGAGGTATTCCAGCGGCGATTCGTCGGATCGCTTGCGCGCATGATAGTACTGTCTCGCCACCGAGAC
GCCAAGATCGCAATACTGGATCTGAAAACTTCGCAATAGCTCGGTCCACTTATTGCGGGTAGATCAAGCCAGTTGGTGATACCAGTTCCTCGCGGGTTCA
GCCAGTAGATCTGCGAACGTCAAGCACTTCTCTTCGTCCGAGGCTTGATCGCGCATGAACACTGATTTGACCTTGCCGATCCAAGCTCTCGCTCGATCTT
CGTCTGGATCTTTCCCCGTGAACTCCTTGAGATCCGAGATCGCGGAGATCCGGACCCGCTGGATCATGGATGTCCCTGCAGATTCGATGGCAGTCGAGGC
CACAGCGGCGCGAGCGGGACTTGGGAAATCCAGGTCGTCGGGATCATACTCCCAGTGGTATGCCTCATGATTTGGCGATCCTACCGactccatctccacg
tcctgtAATCCGGCGTTCTTTGGTTCTTCGGCCACCGGGACAGTTGCTGCGACTTGCTGTTCTGCCAGGAATCGACTCATGGCAGCCTGGAAGTACCTTT
GCAGCGTGCCTGGCGACTCGTTCGACGGGGTAGCGGTTACGATCTGGCCTGCTGCGGGAGCAGACTTCTTCTGCCGGCTCGATCGCGGATCCTGACGTCG
GATCTTCGAtcgcgcttcctgcagcgacgcacCGGAGGGACCGAGCACCATTCGCCGCGGCTCTGACGAAGCGTCCGATCCATCCTCGGCTGCCGAAGCA
TAGTGCGACGACGCAGTAGCGCTGATCCGGGATGTTGACTCCGGATCCGGGGAGCTGGGAGCTTCACCGACCAAGATCTTCAGCTTCTCAAAGAGACATC
GCGTGGAAAGCTGGATCGAGTCAAGATCCATATCGAACAGGTCATCCGCGACGAACGCACCGGCGAGGGCGTCTGCTTTCTTCAACAGCCGTAGTagctc
cttcaccacctccaaCTTATTGTCCATCACCACAGGAGTGGTCACGGGTTCCTTCGGATCTTGGatctgcttctgcttcagcttcagggTCTGCATCACC
GAATCCTGATCCAGGAAATCGCGTCGTTCCTTATGGTGGAACAAGTGCTCCAGAACGTCTTCGGACCAGCTGAATGCGGGTTCGCTGAGATCCTCGCCTT
CCAGCTCTGGtgccttcatcttcatcctcttcgtTTCTTGATCAACTCGTGAGACTAGCGGGACTTCGTACGGGTACGGCGTTAGCTTAACCGGCGGATC
TGCGAATGTATGCCGTTTAGCTTTCACTTTCCCTTGATTTGTTGGCAGATCTCGACGCGGGTCGAGATCCGCCGGGGTCCCCGAGGGGACCTGTGGAGGA
ATTGGAGGTTTACCTTCTAGATCTGTCGCCAGATCGCCCTCCGTTCCATCGACAGAGTTCCTTGCAGCACTCTGCCGATCTGTGGATCTTGCTTCAttga
gcagcgtcgtcgtcgattCCAAGTCCGATGACGCTTGTTCCCCTTGTTCAGTCTTCACTTGAACTTCTTCTAGGGACTCACGGTGAAATCCCGAGTCACC
AAAAgatccgggcacgcgcaccattGTGGAGTAGTGGGATCAGCAGAAATCTTGTTAATGCTGGATCCGACTTCCCACtgcgcccagacaccgactaacg
gaggggtCCCCCGATGatccgtgatcgtgctgaactGGTCACCTTGAGTACCCGTCGGTAGGGCTGGATCTTGCTCTCTTGGT