Description :
From Genome Similarity Track
Location :
Scaffold_17:83888- 85205
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007176Similar to myoB: Myosin IB heavy chain (Dictyostelium discoideum)

Sequence
1317 bases(100 bases per row)
TGAGCGAGGACTCGATCCTCGTGAACCTCAAGATGCGCCATGCCGCCGATGTGATCTATTCGTATATCGGCCATGTGCTCGTGGTCGTGAACCCGTACAA
GTGGCTCGATATCTACGACGAGCAGAGCATGAAGGCGTACACCCACAAAGCGCGCATTGATGTTCCTCCACATGTGTTTGCGACGGCCGAAGAAACGTAC
CGAACGATGATCAGCGAAGAAGACAATCAGTGTGTGATCATCAGTGGCGAAAGTGGTGCCGGCAAGACGGAGGCGTCGAAGCAGATCCAGAACTATATTG
CGGGCGTGAGTGGCAGTGGTGCGGGTGTCGACAAGGTGAAGCGCACTTTTTTGGAGAGTAATCCACTGCTGGAAGCGTTTGGGAATGCGAAAACGTTGCG
CAACAACAACTCGAGTCGATTTGGCAAGTACTTTGAGCTCCTTTTCGACTCGGCGGGACGACCTCAAGGTGGCAAAGTGACGAATTATCTGCTCGAAAAA
TCGCGCGTCGTGAAACCGGGAAAAGGCGAGCGCAATTTCCACATTTTCTACCAGGTGTTGGCAGGCTTGCCCGATGGAGCGAGACAGAAACTGAGCCTTG
GGTCAGCAGATCAGTTTCAATACCTAAAGGCGAGTGGGTCCTATTCGGTTGATGATGTGGACGACGCAGCGGAGTTTGAAGACACGATGGCGGCAATGCA
GCATGTTGGCATCAAGCGGAAGCAAATCGAGCTCGTGTTGCAGACCGTTGCAGCGGTGCTTCATCTAGGCAACATTCAATTCCAATCCGAAACCATCGGC
GACGCCGAAGGATCTTCTGTACGTGACCGTCGATCGCTTGAAATCGCATGCGACCTTCTTGGTTTGGATGCAGATAAACTGGAACACTCGCTTTGCTACA
AGTTGCTGCAAACAATGGCACCAGGAGGTAAAATTGAATCTTACGAGGTGCCGCAAAATCCAAGTCAAGCAAAGTCGCAGAGAGATTCTATCGCAAAAAA
CGTCTATGACCGACTGTTTGATTTCCTCGTCGAGCGCATCAACCACGCGCTTGATATTGAGAAGAAAGCGGAGAAGAGTGGGGAAATCCTGAACGAAGAG
GACATGACCAAGATCGGGATTTTGGATATCTACGGATTCGAGATTTTCGACAAAAATGGCTTCGAGCAGTTCTGCATCAACTACGTCAATGAGAAGCTGC
AGCAGATTTTCATTGAGCTCACTTTGAAAAGTGAGCAGGAAGAATACGCTCGAGAAGGCATTGCATGGGCTCCGATTCCGTTCTTCAACAACCAAGTTGT
ATGTGATTTGATCGAAG