Description :
From Genome Similarity Track
Location :
Scaffold_169:83883- 85249
Transcript NameFunction/comments
Aphin_H310_12185Hypothetical protein

Sequence
1366 bases(100 bases per row)
CGTCATGTACGCGATCTACGAGGGTGATGTGCCTCTGCTCGAGTACATCCACTCGCACGTGTTCAGCCTCCTCAACTGCGGCGAATTCCTTGTCGATCTG
GCAGCGTGGGCTGGTCACGTCTCTGTGGTTGAGTTCCTCCTGGATATTCAGCACCCCGGCTACACCTTCCACGCTTCGTTCTTGGCTTGCCGCGGGGGCC
ATCTCGACGTCGTTCGCTATCTCGACGAATCGAATCTTCCCTTCACTCGCCAGTGCTTGGACGTTGCGGCCGGGCAAGGGCATTTGGACGTCGTGCGGTT
TTTGCATTCGAACCGAGCGGAAGGATGCTCGACCAACGCGATGGATCAAGCAGCGGCAAACGGCCATTTCGACGTGGTGCAGTTCCTGCATGCTCAGCGC
CGCGAAGGCTGCACGGAGTTCGCAATGGACGATGCGGCAGCGAATGGCCACTTTGAAATTGTGCAGTTCCTGCACTCGGAGAGAAAGGAAGGGTGCACGG
ATAGAGCTCAGTGTGGAGCGGCCGAGGGCGGCCACCTGGACATTCTGTGCTTCTTGCATACGCATAGAACTGAAGGGTGCGCACCCTACGCCTTGGATGA
CGCCGCCTCCCATGGGCATTTGGACGTCGTCGAGTGGCTATATGGCGCATACCACATGGCGATAACTACGACTGCGATCGAGGCGGCGGCTAGTCATGGG
CACTTCGACATCGTGAAGTTCTTGGTGAACCACATGGAGACCGACGTAGTGACTGACGACGCATTGTTGAGTTCCGTGATGACGCCGCCAATCTTCAAGC
TCTTGTTCCGTGCCAAATACAAGCAATTGTACTACGTGATGCCACCGTCGGTCATGGAGGCCATCGTGCGCGCGAACCAGTTGGAGTTGGTCCGATTCGT
CCACGAAGAAAAATCGAGAAGACTGCATTGCTTTACCAAACGCACGCTGGATGTGGCCCTCGAGTGTGGGCACTGGAATATAGCAATGTTCCTCCATGCG
CATCGCCGCGAAGGGTGCACAACAGCGGCCATGGACGCCGCTGCGGCCAAGGGGCACCTATCCATCGTCGAATTTCTCCACCACAATCGTACAGAAGGCT
GCACGACCCGCGCGATGGACATGGCAGCCACCCATGGCCACATCGACATCGTGAGGTTTCTCCATCACCATCGCACGGAAGGCGCCACGGTACTCGCTAT
AGATGGCGCCGCGGCCAATGGACATTTCGAAATTGTGAAATTCTTGCTCATCCACCGACAGGAAGGGGCGACAGAGCAAGCGATGGCGGGTGCCGTGTCG
AACGGGTATTTGAATATCGTCAAGTTTTTGCATGTGCACCAGGCGAAGGCATGCACGTCATCAGCG