Description :
From Genome Similarity Track
Location :
Scaffold_57:83859- 86854
Sequence
2995 bases(100 bases per row)
TCGATGGCGTGACAGGTCACGTAGTTGGTGAGGTCGGCCTTGCGGCCCTCCCATCGTTAACTGCTCTGTTGGAGCTAGACAAAATGTCTGTAGATGAGTT
CAGTCAGGACTTGGAGGAAAGCGACTTATCCGATATGGTGGTCCGTAGACCCCGATAACGAGTTGAACTCCTTGTTAGTATTGGATGAGACGGTCCTTGA
AAGTACAAAGGTGGCACTTAGTGCTCGTAGTGGATCATCTTATAAAGAATCCTTCGGATCGCTACTACCCTTTGGTTAAAAAATTTAACGGCGTGGTATG
TCATAATATACCTTCTTTCCTAACTTTCGATAGAGGTGTAAGTCATGAAATTGTCGTGGTTCGTGGAACCAAATACTGCATTACACGGCAGTGACCTTTA
CCAAAGGAACAATGTGATGTTATTGACGAGTTTATCAGTGTTAAGCACGCAGCGGGAATGGTACGTGAGAGCAAGTCTCCTCATTCCACATCGACATTTT
GTGTCAAAAAGCCTAATGGTAAGTGGTGTATTGTGCATGCTTATAATAATCTCAATGCGGCCACTATACTGGCACAAACACCCATTCATCGTAAGGATAT
TCTTCAGAGCAACATGGCAGGATGTAAAATGTACAGTGCACTCGACCTGGTTGATGGTTATTATCAACTGATCATGCGAGCAAGTGATATTCCGGTCAGA
GCGGTTATTACTGCAAGCGGTATGCTTTAAGCGTGGCTGGTTATGCCTTAGGGGCTTTCCAATGCCCCGGCTACATTTAATCAATTGGTTATATAGCTGC
TCCGCCCTCGTCGTGCTTATGCACAAACGTATTTTGATGACATGTATGTCTATAGCCGAGAGCGGAAAAGGGTCGGTCGACGTGGATAACCACATCGACC
ACTAACGAGCTGTGCTTCAGTGCATGCACACAAATAAGCTGTACACTTATGCGTCAAAATACGTCTTTAGTTCGGACGAGATCCCATTTTTGGGATGCTA
TATTGAAAAGATAGGCCTTCGAGCGGATCCCGCAAAGGTTAAGGCCATAGTGGATTGACCAGTTCCTTAAAACCAAAAGGTCTGCGCAAGTGGCTTGGAC
TTGTCAATTACTTGCATAAGTATAGCGATAATTACACTGATATGGATCGAATATTGTCCAATCTCCTTAAAATGGATGTGGAGTGGTGCTGGACTAGCAC
CGAAGATAAGGCTTTTATGGCCGTGAAGGTAAGTCTCCTACATGCCCCGATTTTGGCTATGCCAGACCCTGATCGACATTTCAGAGTCGTTTGTAACGCT
CCTAGTTTTTCCATTGGCTGCGCTCTGTTACAAACAGATGTTGAGGAATGCGAGTGTGTCATCGCTTTTGAATTCCGTCAGCTTAAAGCTGCTGAAAAGA
ACTATCCCGTTCATGACAAGGAGCTACTTGCTATGAAGTATGCTCTAGTCAAATTTAGAGTTCATCTGCTTAACTCTAAGCCTTCCATGGTCTAACTGAT
CACGTGTCTCTATGAACTGCGACCCAATCGCCTCACCTTCCGCAGAGGGTGAGCCGTTGGCTTTCATTCTTTGCAGAATACAACTTCAAGGTGAAGCATA
AGCCAGGGAGGCAAAATACTTTGGTTGATGCGTTGTTAATCCTGCCTGATTATGAACTTTCTCATGTTACGATTATGTCGTTGTCAGTTAATGACTTAAT
CCGTGCATCTTATACCAAGGAACAATGTGTAGCTTTCTACGAGCTCTTGGAAGCGATGAGTTTAAGGACTCGTACATTAAACTGTCGGCACGCTAGCGTG
CGGGGCTACATCGATATTTTCTATCGGTAATGGCCTGTTATGCTATTGCACGGATTCTGCGGATACCCCGCGCATAGTTGTTTTTCATGATGAGGAACTG
AAGTATCGAATTCTCTGAGGTCCACAACACAGCCATTAGCGGTCATCTCGGTCGTGAGAAGACCTACGGCTTAGTTAGCCAGAGTTATCGGTGGTCCAAA
CTCTATAAATGGGTAAGTACTTATGTGCGCACATGTGAGACGTGCCAATGGGTCAAAACCCCAACACATTCGGCTGCGCCGTTGGCTAGTTTGCCTGTAC
CATCTGGGTGTTGGGAGTACATCAGCATAGATTTTTTGTTTGGCCTACCAAAGGATTCGGTCGGCAACACGGGTATTGTGGTCTTTGTCGATCTTTTGAG
CAAGATGAATCACTTAGCGGCTGTGCTGGACTCCATTGATGGTGAAGGTACAGATTTGATGTTCATTGATCGCGTGTTTTGACAACACGGTCTGCCACTG
GCAATTGTCTCTGACAGAGACTCTCGTTTTACAGGTTAAATGTGAAATTCCATCTTTAAGGTGCTTGGCAAGAAATTAGACATGTCTACAACGGATCATC
CGCAGGCCGATGGTCAGAGTGAGCGCTTTAATCGCTTCCTCGAAGATGCCCTACTCAGCGTGTGCGCTGATGCGCGTTGGAGCTCAATGCGACCCCATCG
TTGAGTTCGCCATGAACAATGCCGTCAATGCCTCGACTGGCTATTCTCCGTTCTACTTGATCAGCCTCACACACACCCGCGTTCCATTTAGCACTCCCAC
TACGTGGTTCAAGTCTTGGTGGGGGGGAGGTGGCCGATTGGCTTGCTGATGTCAGCCCTGCTACTGTTCAAAACCAGGTTAGCGCGTTTCTAACAAGGCG
ATTGTATGTCTTAAGACATGTGCGTGACACAATGGCTGATAGTCAAGACAAACAAAAGTAACAAGCGGATGCTAAAGGCAGAAGATGTATTGAAAGTTAT
GAGGTCGGTGACAAAGTCTTACTAAACGCTAAGAATCTACCTACAAATGTAGTGTCTGCTGTGTTTACGACGAAGCCGCTTCCTCGCTTCTTAGGACCAC
TTACGGTTGTGGCCAAGAAGGATCCTTCGTATACGCTCAACTTTATTGCGTACACTCCCCATGTTTTACGTCGGGCTTCTTAAGCCGTATCGGGA