Description :
From Genome Similarity Track
Location :
Scaffold_1361:8385- 9479
Transcript NameFunction/comments
Phypl_g13216hypothetical protein

Sequence
1094 bases(100 bases per row)
GAAGCCAGCCGTCAGCTCGAAACGACGTGGGCGTAACTGGGGTTTGGAGCACGTTCCAGGGCGTGCCCCAGTACAACGTCGTTatctgcttcttggtgat
caGATCCGTTGATTATTGTTTTCTCTTGGGGGCATGACCATGCCGAGGGAAGAGCCAATACTTGGGTTGGGAAAAGTCAGCTCCACATCCATTTCCAGCA
CACTACCTCGCCGCAGACAGATAGGGTTCCAAggagcgacagcggcggccgGAAACCGACCGCGATCGCGATATCCAGGGGACCCATTGCGCTCGAGGAA
TCAACGTTAGCGGAAGTCGGCCCCAATCCGCGGCAGACAGCAAAGCATTGCGATGGTCACGAGGCTCGCTATTCACGCTGTGGTCATTGGCCCGATCAAG
ATCACTCTGACCCCCCGCTGACGCGCTTGAGGCTGCACCATCACGCTCGGCCGAATTCGCAGCAGAGCTGGAATTATCCtttccgtcgctgccgctaTTG
CGATCAGAATGGGATCCACTATCAGACACGGCCGAATCACTATCCCGGTCAGAAGACTCGTCGGAACCTTCGGAGGAGTCAATACGTATTGGCTGATTAG
GAGATCCGCCACTGGAGGCTCCAGATGAAGAGCGCCGGCGGAGAGAGGCCCACGACTGTGCCACCCCTGCATGAAGAGGATCGTCGCTCACCGAAGAAGA
GAATGTGGATCGTACCGAACggctggaggcggcggctcgtCCTCGACTTCCGCCCCGAAGACGTTGAGAAGCAGGCGCGGAGGAGCGATCTGCTGACGTC
TGGGTGGGCGAGGGTCTCGGACGGGAAAGCGCAGTGGTGGCAGATCGAGCAGGTGACGCAAGCGGGGCTGACGTAGAAGCATGAGGCGAGCACCGAGATC
GCCGACTAGGACGAGCGGAAGTCGCAGTTGATCGAGACGACCCGCTGCGACGACGCTTGGTGTGAGAAGAGGCCGAGGCCAGATACCCAGCGGGAGGAAC
GGTCGAAGCAGCCACGGTGGCCGAGGGAGCCGTGTCCGGCTGTACGAAGGAGACCAGCCCCGCCACTCGATCACGGATGGCGTCTCGATCACGG