Description :
From Genome Similarity Track
Location :
Scaffold_5:838425- 842467
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04587hypothetical protein

Sequence
4042 bases(100 bases per row)
ACTGACAGGAGCAGTAAATGCCAGCGAACAGGTACTGCAGATCGATGTCGTAAAAGATGACGACGACAGGACCAGGCGGAACGAGCCTGTTCCGGCCACT
GCGTCCGGTGTCAGCGACAACGACTGCACCTCAGCCCCCAATCGGAACAGACAAGCACCTGGATAGCACGTTAATGTAGCGCCTGTCGGGTCCACCATTC
GCACATCGTACGACGTCACGGCTTTAGCATTTGCCGCCAAAGCAGACGGATCCCACCAGCTCAAACGGTAGTGCGTGATCGTCGCGCCCCCATTCCCTGC
CGTGAACCCCAGTGCGTCTTTTGTAGGCTGGACAAAGTTCACCTCGATCTGCGTTGGCTGGTCTTGAGAACTCACCTGCATGGTCACAGACGTCGGGCGG
AACGGGGTCACTGCTCGCGGTGTCAAACTCTTGACTCCTACTAGAACGGTAACAACCGCCGTGCCTCCAGCAGTGTTAGGCGTGCTTACGGACAGGACTT
GAGCGAGGACCGGGGAGCCGTAGTTCCCGTTGTAAGCCGAAACGCGCACGTATTGCTTCGTGTTGGCAGGTAGACTCAGAATGGTGTACGCGATGCGACC
GTCAGCCCCAACGGGAGTCGCACTAATCACTTGCGAGTTAGCTGCAGCGGTGGCGTAGTTAGTTCTGGTGCCGCTACTACTAATGGATCCAGCTCGACAC
ACAGCAAAGTCCGGCGTTGTGCTCCACTCCACGAGATACTTGGAAGTTAATGGCGACAGTGACGGCAGCCAGCTTACACCAAGTGAGGCAGCGTCTACAA
TGGAAACGCGTACGTCGCGCGGTCCTGTGGCGGATACAGGTCGCGGTCGAATGGTTAAGGAACCGTCTTCGATCGGGGTTACTACCTCCAGAGGCGTGAC
TGTACTTTGTCCCGTATGCGTCACTGTTAGAGCTCCAAGCGCACTGGCCTGTACTCCATCAACCGAAGCTGTACGGAACGTAATACTCCAAGTCATTAAC
AGGTCGCTGGGTGTGTCCACGCCACTGGTATCATAGGGCGTAGCTGCAGGTCCCTTGGAGTAGTCCGAACGCTTGACCAACAGGATGCCTACGACTGAAA
GACTCTGCAACGCGCTTTGCAGCTCCAGCGCACTAGAGATAACTCCTATTGTTACCGTCTTGGTAGGATAATTAGCGAAGGACAGCGTCATCATCTCGGT
AGCAAGCGCTACCTCGTCGAGTGTCGTCCCCGAGACAGTGATATGACTTACTCGCTCGTGAGCGTCGACCGGCTGTGCCGTCACTGGGGAGCCGTAGCCC
CGTGCGTTGTAGGCGACAACCGAAACGAAATAGTCCTTGCTTGAACTCAATCCAGTGATCCTATAGTCGAACAACTCGTCGTCTTTTTCTCCAACCAGAA
CGATATCTGAACCTGAAAAAATACTCTGTAAGTCGAAGCTCGCACTGACGTCCCATTGCACCTTGTAGTGTACCACACGAGCGCCTCCATCGTCCAGAGG
AGCTTGCCACGATACTCCCAGACTATCTGTTGCTAGAGGAGCGACTTGAGCGTTCTGCACTTCCAACGAGGGTCTTGCCACTGGCTGGAACGCACCAGGT
ATGGTCACAAACTTGCTCGTAAACTGTTCGTTAGATGCCGCGAGACGAACCACGTAGTTCGTGGTGTTTGTTAGCTGGTTCAATATCGCCTGAGTGGGTA
ATCCTCCCTGTTCAAGCTTCAAACCCTCCACACACGGCGTTACGCCTGTGAGTGTACCGCCACAAGCCCTTGACGTAAACGGGAGCGTGGCGTCCGTCCG
TACGCCCAGCAACGGCAGGTCGTCCATTGAGCTAATGAACGTCAGGTCCCAGTACACGCCGTGTCGTGTTGCCGGGAAAGTCGAGCGCGCCGAGACTTCA
CCTGTTACAGTCACAGACACCTCACCAACCGTCGATAACCCCTCCAGCGCGACTCGAACGTCTTCCGACGTGGCGTCCACCGCTAATGCGCCCGTAGATT
CACCTCCAACGCTCAGCATCACCGTTCCACCCAAATCTACAGGAGATCCGCTGTAGATGAAAACTCGCTGGACTTCGTGCTGTGGCGTCACGACCACCGT
AGTGACGGCAGCTCCTGTCATACTACTACTGTCGACACTGCCCTTCACCAGTTCCGTGACACTCAGAGCCAACGCCGACATGTAGTCGGGCGACCTGTCC
AAGCTCTCGTAAATGGTTTCCGAGATTTCAATGAGCGGCACGTCTCCGATTGAGTCGCTGAACGTGACGACCCACTCGTAGCCATACCCCGAGAAAACGC
CGACACTGTTGCGACTTACACGTGCAATCGCGCCTGGAACATTCAAAGCGTTGGCGAGTGCAGAGCGCAGGTCGTCGCTCGATACGTTGCCCAGTACTGT
CGTCGACCCAGACACGTCACCGACGCGAAGTCTCATCATTAAACGCCGCTGCGATAAATCGCCCAGCGAGCTGTCTGCCTTGATCAGTTGCTGCTCGGCG
ACGCCCCGCCGAGCTGCGATCTGCACAGTGTAATTGGATACAGGAGCTCCTCCTGTGTTCAGAGGCTGCGTCCACGATACGAGCAACTTGGTAGGCGAAC
GTGGCTCAACATTCACGTCTCGCGGCGCGTCCGGGACGCTCTGTACTATGAACCGAGCGGGCGTAGACGCTCGCGTCGTGCCAAATACGTTGCCTACGCC
GTTCCACGCTGACACTCGCACGTGATATCCTACACCAAGACGCAGTCCCCGCACGTCGTAGTGCGCCATCCCATCGTCACTGATACTCAAGTCGGTCTTT
TTCACTATTGCGACGCCGTACAGATCACTGTTCATCGCCGGGAGACCGCCACCCTGTGTGCGCGTTGTATCACACGACTTTGTAGCCGTCGTTAACGAGC
TGGTGAGGTCTAAGCCAATGCAACTGACAAGCGGACGGTTCGGTCCCAGACGCGACTTGTACACGATCGTGTAGACGAAGCCCGTGGGGGTCGCACTTTG
CCGCTTGTACACGTCGATGTCTCCAACCAAATCACCAGCGTCCGTGATCTTTGTCAGCGCGTGCTTTACAGCCGTCGCGGATGCATTCGCTGGGATGGAC
GCTGTCTGTTGCTGGTTGTAACTCAAACGGAAGAACCCGCCCAGAGTTCCTGCACTAGTTGAAACCTTGACAATCTGCTGTTCGAAGCCATTGAACGCGC
GTATGAGCGTCGCCGTCGCTAGTTTAGCCCCCGTGCCGGTTAACGTACTGGTCGCCGTCTGTGAGGTACTGAACGCCGTAAGAAGCTGCGTGCTGTCCGT
CGACACCTTCAGTAGCGAGATGTCTCCATACACGTCGCCCGTAGATGTATCTGCACGGAACGGCGAGGTCAAGAACGTCACGAACCACGCGTATCCGAAC
CCAGCAGCAACGCGGCGAACGCTGACGCGACCAACAGTTGGTAGCGCCTCCAATGCAGCGGTAATAGCGTCCGATGAAGCATCCCAAGGCAAACTCGAAG
TCACGGCATCTAGGAATGCCAACCGGAAAGAACCGCGCACGTCGTACGCCGTCGCTGAGAGCAGTAAGAGCTGTGTTGTGTATTCTGCAAACAGCACACG
GTTGATCAGACTGGTCGAGATAGTCGCAGCCGTCTTCGCACTCGAGATAGCAGCCACAACATCCGGGATCACAGCGTCCAGATCCATTACATCCCACTCG
ATCTGGTACTGCGTGACGTCGGCACCGCCGTTGTCAGAACTGTCACTCGATGTGTTGAATGATACGGTCAGGCCTCGATCTTTCGTTGCAGTAAGGAATA
CGTGGACTGGGGGTTCTGAAAGCGTTTTGGGCACTCCAAATCCAGGTACAACGGGGTAACCAGCCTCGACCGAGTAGCCGAGCGAGTTGTAGGCGTAGAC
ACGCACGTAATACGGCGTGCCGCGCTCCAGTGATCCAATGACAGCCTCACATGGCGTCAATAGACAATCGACGCCGGGATTCACCACAGCTTTACGTTCG
TACCCGAGCGAGCTGCCTTTGGAGCTTTCCCCCGCGGAATCA