Description :
From Genome Similarity Track
Location :
Scaffold_112:83839- 85133
Transcript NameFunction/comments
Physo_109469putative polyprotein

Sequence
1294 bases(100 bases per row)
CTGTGTTTTGAGGGGGTGTCACGCGTCTATAAACCCCGCTAGAATGACGTTGAATCTCTACAATAGTGACATGCAACGTCAACTTCAATCATGGTCGCAA
CCCCTCACTCGACCTGCGCTACCATTCAACGTCAACTTCAAGCATGCATGAAAGCCTACCGCGAGTATGCCAGTGCATGCATTAGTATTGGTGTCATTCC
CGCAGGCTTTAGATACCATGCATTAGTTCAGCACGGAAAATATAAAATCCAAAACGTTGGTCATAAACTAAACAAGGCAGTATATTACAAAGCCATAGAA
TATGTTTAATTGTTCATTTTAACAAGAGTACGAGCGTGGTAGTCCATTGCAACATTTGTGGAAAACTTATGTACCGATAGTTCAACCAACATTTCTAAAG
TGTCACTACACTTTCAACCTCACAGCGCTGCATTTATACTTGAACTTTTCCTCACGATGAGGACAGGTGAACTCTACATACCTGAATGCTCTCGTCGACT
CGAACACCTTCGCCTAAATTGCTGGATACCATGCTCGGGTAATTCCTTGAGCATGATTTTAGCTTTAACAACCTTGTTTACCGCTCAAAATTACAACATC
GCGCACCCTCGTTACTGTTGTTGTCCAAGTAAGTGATGACGCCCGGGTAGGTCAGCATCGTTCGAACTACATGGTACTCATACGAGATTTTGAGTGGCAA
TCATTTCACAATATCCGGTTGTAACTATTTGGCTGTTGCATCTACCCTATGAGTGTTGTAACATCGTTTTATGTTGCTCTTTAGGCAAACATTAAACATA
AAGCAACGGGCCACGATACTTTACTGCATTTAATGTTCGTCCTTCTATATTACCGGTGGTAGTGTAGGATGTCACGCTCCACAACAACTTTTACACAGCG
GAAACCAGCATGTTGGTTTGTAGCTTGTGATTGAGGGAGCAAATTCCGAAGTGAGATTAAATGTTATCGTCTCTCAAACTACTCTCTAGTCTTCCCCTCC
TGCTTTCCTTCTTGTTCTCCTTGTGCTCGTTGGTGCCTCTCATCAGACGGATTACTCCCGGGTTCCGATTGACTTGATCTCAGTATTCTTAGGTCTCCCT
GACCAGCCATTGGTATATCCAGAGCCCGGCTGCCGCCGGCTCTCCCGTCGCCGTCGGATCCTCCGAGTCATCGGCGGATGTGTCCACACGTTCTCCTCGT
CCATGTGCATCTATTGGCGGTGCTTCCGAAGACTCATGAACACTCCCACTCGCCGCTAATGCTGCACGACCGTCCCGACGATTTCGCTTGCGCT