Description :
From Genome Similarity Track
Location :
Scaffold_77:83833- 84940
Sequence
1107 bases(100 bases per row)
TATGGCTTAAGCAAGCCAACATAGAAGACCGGGTGTGCGCATCTTCTTCGAAAGGTTGGGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTGAACGGT
CCTATGAACCGAGGTCTCAGCTTCGTCTTGAAGACTGCAGACACTGCATGAGTAGGTAGGGTTTTAGCGTTTAATAAAACTTGGTCACCGACCTTAAACC
ACTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGTTCAGTCTTAA
AGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGGCCTGAGCCACTGCGTGGC
GGCGTCAGTGGGACGCGAGGATTAACCAAGCCGCTCACATAGAACGAAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTG
GGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCAGTTTGACCATCGGTCTGCGG
ATGGTCCGCTGTGGACATGTCCAAACGAGTGCCTAGCACTCTGAAGAGGGACGTCCAGACCTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCC
TCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAACAGCAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACCGCCGCTAAATGAGCCATCTTGC
TCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGACCATACTCATAGACTGCCAACATCCCTTGGG
GACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATC
TTGGGCCACCAATACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACT
TTAGATC