Description :
From Genome Similarity Track
Location :
Scaffold_58:83822- 85769
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10854Hypothetical protein

Sequence
1947 bases(100 bases per row)
GTGGCACGAAGTAAGAAGCCATCGATCGTCATGATGAGCGCTAAGATCCACCCAGAGCTCTCTGCGTACGAAGCAGCCGTGGAGATGCTGCACCAATCGG
CAAACTACGTCTACCAGAGTGCGCTCGCGTGGCACTTGCAGCCGCAGCTCGCCATCGACGGCGTCGACGGTGCTCTCTCGTGGCCGACGACGCACTATCA
AAGCCAGCAACTTGCAGCGCGCTACGCCCACCACTGCATCCTTCCAGCGACTTGCGTTCGCATCGCCAACAAGGCCGCCTGGACATCGCTTCTCCAAACG
AGCTTGTTGCCCGCTGTTCAAAAGACGCTAGGTGTCACCAGCATCCGAGTCGGGGCCGTCTACTCTCATCTTTGCATCGATGCGCACGGCTCGTCGGCGA
GCCTCACACCGCGACCAAACATTGCTTACGCCTTTGGGACGCTCCTCATCACGCTGCCGGCATCGGAAAAAGGCGGCACGATGACAGTTGCCCGCGGCAG
TCACTCGACAACGCAGTGTCCATCGCCATTGACGGCACAAGTCTTGGCGACGTTCTCGGATGCAACCATCATGTCGGCGCCTATCACGTCACGTCGTCGC
GTTGTGCTTGTCTACGCACTGGTGGCTGTCGATGGCGACGTCGTTAAAGTGCCGCCGACCCGCACCGCCGCCCTCGCCGCGTTGACGGCGATCGCCGAGC
GTCCGCCGCTTCGACTGCAGCGCATTGGCGTTCGCTTCAAGACGTGCAATCGGTGTCGCATCGCTTCATTTTCGGACCTTGGGCCACAGGACGCTACTTT
GGTCGACGCTCTTTTGGCGACGGGCCGCTTTGACGTGGCGCTCGTCCAGCTCAAGGCACCCGCTCTTCACTATGGCGAGAAACGCAGCTACATTATCACC
AAGGCCATGCTACACCCCGCGTCCTCGATGCCCTCCGACATCGCCGTCACAGGCCATTCGGTCGACGCAGTTGTGGGTGCCCAATGGCATGGAGTCATTT
GCTGCGCTTTCGTGTTTTGGCCCTCGTCGTTTCGCACGAGCTTTGTGGGCCTCGACCTCGCGCTGCGTCTCGCACACGGCGCGATCGCCACGACGGAAGG
CACTGGTCGCCTTGGGCTGAGCGTCCGCGATCTTGTTCGCGGAACCGTAGCCACCTTTGCAAGGACGACACCACCGTCACGTGCGAGGAGCGTGGCGCAC
CTCGTGGTTCAGAGCCGCGACGTGGACCTCGTGGACCGTTATCTGCGTGATGTGATGCCGGTGACCACCACGCTGGGCGACATGGCCACTACCGTTCATA
CGTGCTTGCACGCATATGGCTGGACGACAATCTATCCCGCGCTCGAAGCCTTTTTGGAGCGCTGGCTGACGGCACGTGAAGCGAGCGGCGTGAGTCATCT
CGTCACGAGTCTGGCTGGCATCTTCACCGGCGTCACCGCGCTGTGCCCACCGTTGCGACAGCCCTTTGTGGGCGAGTTTGTCAAAATGTGCTGGCAGCAT
TTGCTCAAGACGACGGCCCCGCCCATGCAGCATTGGATCCTCGTGGACGCGTACTTGATGGACAAAGTGCCGCACCTCGTGCGTGGCAACTGGCTCGACG
TGCGGCTACCGCCCGCGCTCGTTGGTATGGTCGATGGTTTTCTCTATGGACGCTTCTTTGTATCGGCACTCGCACGCAAGCAGGTGTCGGCGTCGAAGCA
ACTCCAGCAGCTGCCATTTGGGCTCGTCCAGGCCATTGCAAGCCACCCGACGCTGCCCCAGCAACGGTACCTTGACGTGCTGGCGACCTCGATCAACGAA
CTCGTGCGCACCAGTGTCGACGTCGGGCGGGAGAAACCGCAAGCCGTGTCGTCGAGTGATGTTGGCAACATCATGGATGCCATGCACCGTCTAGGCTGCA
TCAATGCGGCACTGCTGACGGCGTGTCGAGTGATTAGCAGCCCCGAG