Description :
From Genome Similarity Track
Location :
Scaffold_942:838- 3972
Sequence
3134 bases(100 bases per row)
AAAGAGTTGCTACTACAACTAGAACGGGAAGGAAAGTTCACAATTCGGAGGATTCGATCAGACGGTGGTACTGAATTTGTGAATACGGCCCTTAAAGAGT
TTTGCACAGAGAAAGGGGTGGCGTTTCAGACGTCGAATCCATATACTCCAGAAGAAAATGGAGCGGCTGAGAGAGATCATCAGACGAAAATGGCTAAAGT
GCGGTGCGCACTCAGAGATGCAAACCTACCAGCTAAGTAATGGCCTGAAGCACTAAAGTACATGACATATGTGCAGAATTGCACGCCTATGAACAGGCTG
ACGAATAAGACACCATACGAGTTAGTAAAAGGTGTGAGTCCCGATGTAAAGACCTTACATGTTTGGGGCTGTGTGTGCTTTGCATATCTGCCAGAAGCTG
TCAGGAAGAATAAAAAGCTGTCAGCTCGAGCCATAAAGTGCAGGTTTCTCGGGATCTCTGAGGATACAAAAGGGTATCGTCCTCTAGATGTGTACAATAA
CAAGCACATAGTAGCCAGATCGGTTACATTTGACACAGAAAACTGTGCAAATATCATCACACGGTCATTCGGTACCGATCCCGATAAGTTGACCGCTGCG
GAGAAAGATGAGATAGAGTTGCTAGCTACAGTCACGGAGCAAAGGTAAAGCACCACAAGTGTCTCACGGGGATAGCAGTGAACACCCGTTGCCGGTAGCA
GTGGGAGCTAAGAGCAAATCTGGGAAGATACCATCTGAAGGTGGTACAAGGGTAGTACGACCACAACAGAGTCGGAAACGCCCAGTGCGATTTGAAGACT
ACAAATGTTTTCAAACGCACATTGACAAGGCCATTGCAGTCGATAGCATTGTCAATAGGATATCAGTTCCCAAAAATCTTAGGGAAGCGATATCAGGACC
ACAAAGGAAACAGTGGCAACAAGCACTTGATTTGGAGTATCAGTCCTTACTGGAAAATGGAACGTGGAAGCTCACTAGACTACCACCTGGACAAAAGGCA
CTGCCATGTCACTGGGTACTTGCGGTGAAGTACAATGCTGATGGAAGTATAGCGAGGTTTAAAGCACGATTGATTGCACAAGGAAACCATCAGGAATTTG
GGGGTAAATTGCGATGAAGTGAATGCACCGGTAGCTCGGTTTGAGTCACTTCGACTCGTGTTGGCAATAGGAACCATATTGGATTGCCATATCCATCAGA
TAGATGTGCACACGGCCTTTCTAAACGGGTCCACGGACGGAGATGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTG
CGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCT
CGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTG
GATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTT
TGTGCTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCCCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACC
TGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAATTTCGCAATTCCCAA
CCTTCTCCTAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGCTACTGTGCAAATTGAGGTCTGTATTGATATTTAAGC
CTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCCGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCTTCATCCCAGC
TGTGTTATCTTCAGATCCACCGGATCCATGGCGTAATCATTATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACTTCACT
GTAAGTGTACACTCGTCGTAGATCTGAGCTCTCCAATCATCCAACATCATCTTGCAGCCGTCTGTGATCTTCATTGTCCCACGAAAGTTCGAGATCCACT
GTATCCATCATCCCAGCATCCTGGATCCAGGTCGTTCTATGCGGGATCCTCACTCCTTGGATCCGAACTCGGAAGTATGGGATCCGGGACACCTCGCGGT
GGATCTTGACCTCTTGTTAGCCGTGGTTACTAGATCCACCTTCAGATGGCACCTACCATCTTTCCTTCATAGGATCCACACTCGATCCACCCGTATATAG
TATATCCCATATCCATCTAAGTGAGTCCAGGTAAGGGTAGATCCGAGATAGGTCTTGGTGGATCTTGCCTTCCCGTACATCACTCATACCAGATCCACCG
TCATTTCATACGGGGTGCGGCTCGTCATGGCTAATCCACCACAGGCAACTTGCATCCGTGCCAGACAATCCAAATCCTCTCTAATCACTTGGAATTGTCA
CTGATTCGGGATAGTGACCCCGCGTCAGGTCCATTCTCGTATTTCTGAGAAAGCACTTCACCACACTTTACGCGACTTTCTGCATCAAGATCCTGTCATG
CGGATCCTGAATCCACGACAGATCGACGATTCAAGAGAACCGGTGAGAGCACCAATGAAAACGGCGAACAAGTTGGTGGTAGTCAAAGATCTATTACGTT
TGCTTACGGAGTCAGGCATCGTAGCTGGTGCGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCCTTGC
CAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATAGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCT
GAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAG
CCCCGGTGAACGTGAAGGCTCGGGATCCAGTACG