Description :
From Genome Similarity Track
Location :
Scaffold_137:838- 2109
Sequence
1271 bases(100 bases per row)
CAAGGGCGTCAGAATGCGGCCAGCCATCGTAGTAGAGCACGGGAAGGCAGAGTCCGATACGACGTTCATTCTCATATCCGGGCAGACCATGGGATCAAAT
AACTTGGTGCGGAACCCGAGTGATGTGTCCAAGTCGTTATGCGACCCGGGGCAGTTGTGCTTACACCAAATAATGCAGCCGTCCGCTGCAAAGCAGAGCG
TCCCCGTGACGAAGACGGTATACAACCAACTGTTGTACATTGCATTTAGCAGGTCAGCGTTCGATAGCTGTTGGACCTGGAGTCTATTAGATATCAGTAG
CCTTGAATCCTTCTCGCAGAAATATAACTCATATAGCAATATGGTTTTTCCTTACTCTCAGATTCTTACCATCTATAAAGCCGAATGTATGCTTTAAAGG
GGGCTCTCGAGCTCCAACGAGTTTGGCAAGCTCAACCGGACGAGGAGAAGATAGCCACGCGATCCTTGCCGGAGCGTATCCCGTCAGGGCCCTGGACAGC
GTTTCCTCTGTACGCGGTAGGATTCTCGACAGTGTGCTTGATGGTACTCCGAACACCAAGCAAAGGGTGTTCTGCTCCATCGAGCCTACGTAAAAGGACA
ACACGAGACCCAGAACTTGGTGGAGGTATTTTAGCTTAGGCGGTCGACCGCGAGTCGTGTGATGAGGGATGTTGTAGTAGCGACTGAATCGTCGAAGGAG
CTGGTGGAACGCCGATATGATGTTGTTCGAGTTAGACAAATACGAAGGAGTTTAGCTGTAAAACCGACTTACCTGTTCAAGCTTGTAGCATTTAAGAAGT
TGACGTCATTGCCGTACAGCACCATCCACGCCGAGTGACTCGGCGTGTCAAGGCACTGCGTAGTTATGTAGTGTCTGCTCCGCATGACGGTCTTCCATGC
CTCCTCCACTAGCAGCTGGTACACCTCTCGTCGGACCTAGTTCGGTGCCTTGTCATGACTCAAGAAAGCTTCGGTCAGCACCAGCGCGACGTCCGACTGG
TCGTCCACCATCACTTGAGCAAGACGCGCACAAATTCGGAAGTGAGAAGTATGAACGTGAGCGCGTCTGGTGATGCCCGAACAAAGTGACGGATACATTT
GCTAATACAACAAATTATTAAAGCTACTACTGTACCTGATTCAGGGCAATGACATTCGGTCACAGAAATCAGCGGTATACTATTTGTGGTCGATCACTTT
AGCGAAAAGTCAACATTTATCTTCTTAAACGCTGACATATCTGCTGCAGATAAGTCACCCGTTTAATCGAT