Description :
From Genome Similarity Track
Location :
Scaffold_1103:8379- 9484
Transcript NameFunction/comments
Phypl_g12386hypothetical protein PHYSODRAFT_340908

Sequence
1105 bases(100 bases per row)
CAAAGATATGGTCGGCTGGCGCTACCGACATTTCTTAAATCGAGTAGAAACAAACGCATCTGTTGCTAATACATAGCGTGTTGGATGAACTGGCGTCGTG
GGAATATGTATGTATTCACTCGGCGCAATAAGTACATACATATTCAGAAAACTCCTCTCAAACCTAAATATATCTTAAAGCTGCAAGTTCAACCTCGCCC
AGACGGCTATGATACCAGAAGTACTGCAAAACTGTCACAACTCGTTGGAAGGTGGTCACCAGGGCGTGGTTAGAACGTACCAACGAGTGAAGCTGGACTA
CTACTGGTTCGACCTGTACGCAGATGTGGAGAAACACGTGAAGTCGTGTCTTGATTGCAGCTAGAGCAAGAGCAGACCCCAGCTTCGCGGGTACTCGCCT
GGCAACGTCCTCGCCGAACGACCGTTCCAGATCATCTCAATGGATTTTGTTATACCCCTGCCGAAGTTTCGGCGAGGAAACACAGCCCTGCTATTGTTCC
AGTGTTCATTCACGGGATTTGTCATCGCGAAAGCCATGTCAGACACGTCCGCCCTAATGGTAGCTCAAGCATTCGAGGAGTGTATATACCGACGGTTCGG
AGCACCCTCCTTGATTCGACATGATCGAGACCCTCGCTTCATGAGCGAGGTCTTTCAAGCCTTCGCCGACATGACGCAATCTAGGTCACGAGTGACGCTA
AGCTATCGGCCCCAAGCTAACGGGCAACAAGAGCGGTCGGTAAAGACTGTGATGCAGTCCGTGCGGGTGTATGTCGAAGATCCGCTGCAGCAAGGCTGGG
ACGAAATTGCTGAAGACTAGTGTTTGCGATCAACAATTCCCAAGATATGACGCGAAAGGAGACTCCATTCTACCTAGTACATGGGTGGGATGCTCATTCA
ACGCTGTATGCTATGACGACATCGCTCCAACGAGGTCTCAGTAAGCAATCCGAAGCGCTGGCTTGGCGTCGTGAGGTAAACCGACAGCAAGAGTTCGCTC
TCGAAATGGCTAAAGAGTACCAGGCTACAGAGAAGTCTCGAAGAGCGAACGATCACAACGAGGCGTTGAGTCGAATGGAGCGCGCGGCGGTGCCTCGGCA
accag