Description :
From Genome Similarity Track
Location :
scaffold_17:837736- 840338
Sequence
2602 bases(100 bases per row)
AAGGGTACGCTTGAAGCTTTAGTCCTCCACAAAAAAGGAGAGTTGGGGCTACACCCAGATGCTAAGACCTCCTAACACCGTAGTGGCATCTGACCCTCTC
CCCGAAGCGGTATGAGCTGGAAGGTCTCCGAACGAGTGCACCTCGCATTCAAATGTGAGACGCAACTTTCGTGCAGCGAGTGCAGGATGGTGTGCTAAGA
ATTCAAGCTTTACGAGCGTGTCAGAGGCATTGGAAATTTTCATGCCGAGGGAGAAGAGCAATATTTTAGCTGCTGAGAAACTCCGCGGTAACCGCAAACG
TGGTAGTGCAAACCATGTGTGACGAGCGTACCGTAAGAATTTGTCAGGAAACCAGAAAAGACTAGGTTACTCTTACATGAAGTGACCAAGGTAAGTCGAC
TCACTACTTCCGTCGGAAGCTCATATAAAGCTGGAAGAAATTGAAATTCACTTGGGTATCTGTGCAACGAATTTTAAGGCGGTGAAATCACCAAAATCTT
ACGATTGTAATCACAGGAGAAGCTGAGCTCGCCATCCGTACTCGCTAAATCTCTCGTTGAGAAAACGTCAGATATTACTGAGTGCGAGAAGTGGGACAGA
TATTCTCGAGGTTTTAACGATTTCTTTTGATCCTTTGTTGAATACTTATCACCATATGGTGACGAGAAATCAGCCGGAGAAGATAGGTGCGTCGTGAGAT
TGACGTCACTCCTGGAGCTAATGTTGCATTTAGCACTGCAATGACCCAGAACATAGAAGCAGTGTAATGTCATTTACactttttttcgtgcgaagcgaGG
CAAATTCTCCACACCACAGCCACGATTCCTGCGCTGACGCCGGCTCTTCAAATGGTATGCTGAACAGCATGATCGGCTGCACTGTGTTCAGTAGTTATCA
ACAATTTCTAGCAACTCCAAAGAGACACTAATATTCTCCTCATACAGGCGTTTTCAGCGCAAGTTGCGCTAAAAGCGGCTGCTTACGTCGCAAAAACAGT
CAAATGTACTATCGAGGTAAATCTAACGGATGGCACAGCCGTTCAGGTCACATCGTTGCCATAAAAAACCTAGTTACGACCATTTTTGTGCAGCGCAAGT
TGAGCCGGATGGAAAATTACACATTTAACACTTGCGACCGTTGCTCGATTTTATGCGTTAAAATATGCTATTTGGTATTAAAGGCAAGTGTTTTCGCGGT
ACCAACAAAATTTCTTTTCTGGGTTGCTTCTTTGGAAAGCAGAACCCGCGGGCAGATCCCGCGAAATAGGAGCCATTCGAGATTTGACAGTGCTTCTGTT
CcaaaagtggcttggcctggcCACATTCTCGCACAAATATAGTGCAAACTTTGCTGACATGACACCATACTCACGATCTTTTTAAAAGGATGCTTGACGG
CGCCGGGGTGCATCAAAAAGGCGATCCTCAAGTCTGGAGAAAAAAGCCTCGGGCTTGCCCCAATTCTGTCTCTTCTGGATACAGATTTGCCATTTCACGT
TATCTGTTGCATTTCGGTCTTTTGCAATATGCCAATCGCGATAGCGTTAAAGTCTTGCCAGCTGAATGCTGTCGGATGAACGACCCGGTTCGGCAAGACA
ATCATTCGTATTTTCGGACCGGTATAGCATTCGAGTGCGCTACAAGCGGGGTCGGCTTAATGCGGTGATTGATGCGTTTCAGCGTCACCCCGAATATAAA
TTGTCGTATGTTATGGTGGTGGCGTCGCCAACTGAGTAGGTGACAAATACAGCGCAACGGCTAGATGCAACATGTGTAGCGTTATCAATTTATcgaaaac
aagaaattggtagCTCAAATGTTGCTTTATTGAACGCTCGCGTGCACCACTGTACTGTATCCTAGGGATTGGTACTGATCGACATACCACTCAGCGGGCG
GTGGTTTCTCTCGTAATGAGAACCACCAAGTAAAGTATACTGTAAGGGGCAAATGATAACCCTTTCATGGACGAGAAAAGAAATACAGATCCGTAAAACT
ACGTTTTGGTGGTACAACATAAACAGATGGACCAGCTCATGTATAAGCACGTTTGTATGTGTCAGCAGCGAATAATTCTCGCTGCATGTGGCGAAACTTC
TAGATAGCCAATCAATCCCAACCGAGTGTTGGCATTCTTTGAGTAGCCATATTTCGTTCAAATAACACCTTTGATAATACTGGTATTGTGAACTTTGTGA
GCCAGCTGAGCGAATTGCTTCACCTCGCTACTGCCAACGGCAATATGAGAGGCGAGGATCCGGCCATGATGGCCCACGACTAAGTGTTTCGCCAATACGA
TTTGTCGGGATCCATTTTACAAATACATATTCGCGCTATATAACGAAGATTATGCAAACATTATTCGATGTGCATGACATCgctttggatatgtcgattA
CTGCATTCGCGAGCAAATTATTATGCAGAAATCATAAGATTCGCTGTGGGGGAGATCTTCCGACACAATTGCGCCGAATTTAAGAATCTCGCTCCGAAAC
TACAGTATGGCGTTCGAGCAAGATTCTCAAGCCAATGGTTTTGTGTTAAATGGCGCCGTACACCCTTTCACAGGCATTACTCTACTTTACAATTGCTTTG
AT