Description :
From Genome Similarity Track
Location :
Scaffold_113:8377- 14233
Transcript NameFunction/comments
Physo_142365pol protein

Sequence
5856 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGCGAATG
GAGCAGTTCGCTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGCTAGGCCCGGAGGGCGTGACACAACTTGCGCAACAAGACC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGATGGCCGCGGCGCCCCAAGC
GCCCGCTTCGTCATTCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCGAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGCG
CACTAACGTCCGGGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGATCAGCTGAAGCAGCAATTGTCCCGAGTGTTTGCTCTGCCTAACGAGGCGTATCG
CGTGCGCTCACGCTTCCTGGCGACCAGGCAGAGCAAGAAGGAGTTGATGGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGTATGTCTGCGGACCCC
TGCCGGAGGCAGTCACCGTTACAGTGTTCATGGAGGGCCTCCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGC
TGTGAGCATCGCATTGAATGCGGAGCACAACTTTAAGTCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGTCGAGTGGTCCGGAACCCATGGAC
ATCAGCTATGCTGAAAACGAAGAAGCCGAACTTCGTGCTGCTGAGCAGCGTCGCGGTATCCACAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTG
CTGGGTGTCCGCTGCGCCATCAGCGCCAGGCTTCGTCAAGCCGATCTTCGAGTTCGAGCCAGGGCTCTGGTTTGTCTCGGGGAAACGAGAAGTCCCAGTA
GGAGCGGGGCGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCAGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAACA
CGGAACGTGTATGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGATTCACAAAGCCACGGACGATTTTGATCGATTCGGGAGCGTCGGGTAA
CTATGTCGGGCGTTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGTAGTGACATCGTCACTGTTCGTCTCGCGACGGGCACT
CGTGGCACGGTGCCTAAGATCCCTGTGGACCTGGGCGTGAAGTTTTTGGACTTTGATAGCGTGGAACGCTGTCTGGTCTTAGGCCTCGATTCGAGATATG
ATCTCATTCTTGGTATGGTGTGGCTGGAACGCCATGAGCTTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCACTCCTGGCGGAGCATT
GGCGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTCTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGCTGGACATCGGAGTTTCCGAGTTG
GTGGGCACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAGGTGGAGCGGCACTAATTCCGCTGAGCGGGCGTGCGTCTGAGGGCT
ACGCCCTGCTGCGTGCCAGCGACGGCGCGGTCGGCACGATGCCGAAGAACCAGGGGATTTGCCCGGATGAAGATCGTGGAGTGGCACGTAATCCACTGAG
TGGAGGCTGCGGATCGTGCAGCTCTTCGCTGAGTGTCGATAAAGACACTGGAGCTCCCCTGGAGCTGAACGAGGTGGTGACACCTGGCGTCAAGACGCAC
GCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGCAAGGCGTCTGCGATCTCACGAG
TCGAGAAGGGCGTGTCGAGCGGTGAGGCTCCACGCGAGAGCGAGCAACTCTATGCACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCT
CGACGATTTGCCCTCACTGTCTGCTCTCCTGGAGCTGGACGAGATGTCCTTGACCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCTGAGGTAGTG
CTCATGCGACCCGAAGAAGAGGTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGATACCAAGAAGGCGCTGAATGGGCGGAGCGGATCGGCGA
TCCTGAAGGACTCGTCAGATCCCTTGTATCAAATGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGT
TTGACACGAAATCGATCTCGTTCCGGAACGAAGTACTGCGTGACGAGGCAGTGGCCCTTACCGAAGGAGCGGTGTGACGTCATTGACGCGTTCTTCCGTG
CGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACCCCGACGGTCTGCGTCAGAAAGCCGAATGGCAAGTGGTGTATCGTGCATAC
TTTCAACAAGCTGAATGCCGCTACCATTCCGGCGCAGACGCCGATCCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCG
CTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTCTCATTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGG
TGATGCTCCAAGGACTTTTGAACGCGCCAGCGACGTTTAATCGTCTGGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTTGATGA
CATCTTTGTCCACAGTCGTGCGGAGCACGGAAATACTGATATGGAGAACCATGTCGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTG
TACGCCAACACTGACAAATGCATCTTCGGAGCGGAAAAGATGCCCTTCTTAGGGTGCTTCTTTGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCA
AGGCCATTGTTGACTGGCCGGTTCCCAATAACCAAAACGATCTTCGCAAATGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGA
GATGGCTCGGCCACTCTCCAATCTACTGAAGAAGGATGCGGAGTGGTGTTGGAACACCGAGCATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCTTT
CATGCGCCTATTCTGGCTCTGCCAGATCCGGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACG
CCGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTA
TGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACATGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTT
TCGCAAAGGATGGCCCGTTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGTCAGAATGTCCTTGCGGACGCGCTGTCGC
GCAGGCCAACGACCGTGACTTCGTCATTACCGGATCTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCGCTGCTGAAGGCTCTGGGGAGCAA
GGAGTGTCAAGACTCGGACATGAAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCC
GAGGATACGCCCCGCGTGGTCATCCCTCATTATGCGGATCTGAAGTACCGCATCCTCTACGAGGCACACGACACGCCGCTGGCCGGTCATCTTGGCCGTG
AGAAGACCTACAGCTCGGTGAGCACCCACTATTGGCTGCCGGAGCTGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTCAGCGAGTGAA
GTCGTCCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTACCTGTCCCTTCGGGCTGCTGGCAATCCATGAGATGGACTTTGTGTTTGGCCTGCCGGCG
GACGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGAACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAAAGGTACAG
CAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCTCCGCTTCATGGGCAACTTCTGGAGCGCGGT
CTTTGCAGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACCGAGCGCGTAAATCGCGTCGTCGAGGACGTGCTC
CGCAGCATTTGCGCTGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGC
CGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGACCTCGGGCTTGGTGGGGGAGGAGAAGCCGACTTAGCTGATCG
GCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGTGCGTGATGCAATGGCTGAG
AGCCAAGACAAGCAAATGGAACATGCAGATGCCAGGAGCAGAGGCAATGTTGAAATTTATGAGGTCGGGGACCTAGTGTTGCTTAATGCTAAGAACCTAC
CTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGTGCCTTGCGTACACGCTCAA
TCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGAAGGAGGCACCGAGAGTGACG
AGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGAGACCATCCACACGGGCACCGCAGGTACAGGCGGAAGAATCGGCGCCGGAGGTGCTGCGGGCAC
AGCGAGAGCCGCAGGCCAGGAGTCGCGGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTATCTCCC
CGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGCACCCAGTCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCA
TCGCGCCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGACCAGACGTGCATCGACGTCATGGATATGATCCCGAAGGGGGCCCGCCTGCTGCCGC
ACCTCCAAGAGCTCACTTTGAGTCGCGAAGGACCCCACAGCGGCCTCCACCGGCCTTGCTCGATAAGCATGGGAATCTACATTACCATGTGGAGCGCCTC
CTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCC
AAGACTGCCCAGACGTCGTGGACACTTTTGATCAGCTTCATCACCAGCGCCCTGAG