Description :
From Genome Similarity Track
Location :
Scaffold_439:8375- 15153
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_439-fgenesh-gene-0.0Conserved gene of unknown function
Pytar_ATCC12531fgenesh_masked-par_contig_439-abinit-gene-0.16Regulator of chromosome condensation (RCC1)
Pytar_ATCC12531maker-par_contig_439-fgenesh-gene-0.1Guanidinoacetate N-methyltransferase
Pytar_ATCC12531maker-par_contig_439-snap-gene-0.5Gene of unknown function

Sequence
6778 bases(100 bases per row)
CCACATTGCCACAAGCGTCAGCGCCCGAGTACGACTGAGCTACTGGGATATCTCAAATCGCGCACTAGATGTTCGTTTTAATCGCATATACATGATCTGA
CTTTTCTGCATCTACCTGGGTGTGAGGGTCCTCTCGTCTCGTCTACGATGACCCTTTCTGTGCGCGGAACTCCAAGTTCAGATAGTACCCCGACTTGTGC
AAGTACGTCGCCGGCAACTCGACCGGCCGGTTTTGCTCCATCACCTGCGATCAACAATCAATCACCATTTGTCCATCAATCAAAAGCCTTCCATCCATCA
ATCGTAGAGGACGCACCTTTTGGCAGTAAATCTCAAAGTCGTCTTCGGTCATGGGGCCGTATAATAAGCTCCACTTGCTGTCCACGAGGATGAAGTAGTA
CCGCTCGTTCTCGCCGTGCTCGTACCAGCCTTCCTCTCCTTGGACCGTGTTCGGGCACGCATTCAAAATGCCGCTCGAGCTCTTGCCGCTGCCGCTGCGA
TCGCTTTTCTTGCCACCACCCAACAGCGATCGCATCTTCTCACCAATCTTGTTGCCTAATCCCTTCTCCTTCTCTGACGCCTTGCTCTGCTGCTTCGAAG
TCGTTGTACTACTGGTCCCTGCCGCCGCCGCCTCGGTCCGACTTTCGTCGTCTTTGCCCGCGCGCGACGAGCTCTTGGCACCCGCGTCTTTTGTCGTCGT
TGTCGATCCGCTGGTCGCCGCTTTGCTCACATCACGGGCCGTCGTCTTGTCGGCGGTTTTCTCCGCGTCTCCTCCTTTGCTGCGAGCCGAGCTCTTGGCC
TCCTCGTCGCGCTTGGCTCGCCGGGTGCTCTTGTCTCCATTCTCTTGCTCTTCGTCCGACCCACTCTGCTTGCCGCGGTGCTTGTGTCGGCGTCGCGTAC
GGCGCTTGTCATCGTCCGACACGGGGTCGTCGCTTGAGCTGTGGCGGTGTCTTCGCCGCCGGCGGCGGCGACGCCGCGAGTCGTCCGAGCTCTCACCGGT
CGAACTCTCCGACTCGCTGTCGCTATCACGGCCTCGGCGGCGCGCGCTGCGATGGTGGCGGTGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTCGTCGCGCCGCTTCTTCTTCGAGTGCGACGTCTTCTTGCTCTTGCGC
CTGCTGTTGCGCTCGGTCTCCCCTCCGCTTGCCGCGCCGACAGTGTCGCCCTTGGCCTTTTCGTCTGTGCCGTCCTCGTCGTCGTCCTCGCGGCGCTTGC
GGCGTGATGACTTATTCTTCGTCTTGCTCTTGCTCTTCTTGTCCCCGTCGTCGGCGTCTCCTCGCTCCTCGCGGGCTTTGCGTGGCGACCGCGCTGCCGT
CGTCATGGGCTCCTCACCGTCGCTTGTGGCCTCGACGGGCTTCTTCTTCTTGTCTTTCTTCTTCTTGCTCTTTTTGTCCGAGCGGGCCGTGTCCCCACCA
TTGCCCTGGCCGTCCTCGGGGTCGTCGACGAACTCGAGGTACGAGGACGGCACGTACCCGACGGCCTCGCGGAACTCGCACTTGAGGTAGCCCGTGCGTT
TGGGCGAGAGCACCTTGACGACGTCGCCGACGCGGAGAGTGAGTTCTTCGTCGCCCGAGGCCTTTCGGTCCCGCACGACCCGGGCGAGCACAGCACCGTC
TTCTGCGTCCGCTGGAAGAGACGCGACTTGCTTACTGCGAGCCGTGTGGTTGCCGCTGGACCGAGCGGTCGTATTATCGGCGTAGGTGGCGCCACCGCTG
CCGCCGCCATTCCCCGAGTAGGAGTCGATCGAGTCGTCTGTGAGCCCCTGGAGCTGGCGAGCGCCTTGCTTGGGCCTCGAGCTCAGCGCTGGGAGCGTCG
TCTCCACGGGCATTTGTCTTGCCCCTCGCTCGCTGGCGTTGCCTCCGCCACCGTCTCTGGATTGAGATGCACGATGGAGAGGGAAAGTCTGCAAAGGTTG
ATGGTTCCGGCCGAAAAGATCCAGAGAAACGACAGGGGACCGACGTGGCAAAAATACCCCCCTCGCATCCGTGACGCCCAGTGCGTTTATAGGCCGGCTC
AGAACACTGGTCGGGTCTCAGGGCACCACTCAAGAATAGGAGAGAGGAACACCGTGGCTGGAAGCAAGCAAGCTGCAGTCGCGTGGCTCGTGTTGTATCT
GTCATGGAAGTGTGTCTGTTTTGCCTAGCCTGTCTACTCACTCTCGCAGGGAAAAGTCCCGGTCCATCGCGTTCGCGTGGGGTTCACTAAGCACACCGAC
GTGGTGGTCCCCCGCTGAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCACGTGGATGGCGCTCAGCTCGAGCACTTGGAGCGGCTGCAGTTGGTT
CTTGCGGTCACCGTGGCCCAGGCAGTTGGAACTGCCCTTGCCAAACGTAAACACCTTGCCGTCCTCGGTCAGCGCGGCCGTGTACTGCCGGCCGCATGCG
ACCTGGACGACCTTTTCGCCGTGAAGAATGGTCATCTCATGTGGCTCGAGCCAGAGCTTGGAGCCCCACATGAACATGCGGCCGTCGTCCGTCACGGCGG
CCGTGTGGTCATAGCCCGTCGCGAAGTGCGTGATCCTGCGCGAGCTGAAAAACTCGACGGGCGTCGGGATCGCTTCCATGCTGTAAAAGTCCATGGCGAG
ACCTCCGCCAAGGCCGAGCTGGTTGTCTGTCAATACCAATCACTCGGTAAGAGAAAATGACCGAGAGCAATAGAGAGAGACAGAGTAGCCAGCCACGTAC
GGCTATTGACGCCCCAGGCAAAAAGCTCGCCGTTGTTCGTGAGCGCAAACGTGAAGTCGCGGCCGACCGAGATGTGCTCGATCGTTTCGTTGGCGAAAAA
CTCAATGGGCTCGGGTACTTCACACGTGAGCGACTCGCCGTTGCCCAACCGGCCATACTCGCCGTTGCCCCAGGCCCAAACCTCGCCGTCGGTCGAGAGC
GCGACCGTGTGGAGCTCGCCGCACTCGATCTTTGCGATCGGCACGCCCTGGTCCACAAGCGTTCGGATCAGTCGCGGCGTCGGCTCGTCCTGGCCGCCGG
CGTGGCCCAGTCCACCAGCGCCTTTCATAGTCGAGCCGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGATCGACGATCCTGATGCCTTCCAGCGCCTCGACGAGCCGCGGCTCGTCCACAGTCTCTCCTGCCCCAAGGCCCAGA
CCCAGCTTGCCGTACTCGTTCGAGCCCCACGTGTACACGCGGCCATGGACGTCCACTAATAGACATGTACCCACACGACACGCATTAGTCTCTATAATGA
ACAAAGAACCCCACGGATGGACGTACGCGCGGCGCTGTGGTTCATGCCGAACTCGAGTTGCACAATCTCGCATCCTTCGAGCGCCTGCACGAGCCGCGGC
GTGAGCTGCTCGTACGCGCTGCGCATGCCCGACTTGACGACGGGCCCGTGGCCCAGCTGGCCTTGCGTCCCCGTGCCCCACGTGAATACTACACCACAGT
GAATCAGCACCCCCGTTTCTTCTTATTCCGTTGCGGTCCCTCCATCCTGTCCCAACGCACCGCTAGTCTGCGTGGCAAACGACGCTGCGCGCACGCTCTT
TGCATGGAAGATCTGCGACATGTGACGTGGTGTCGCCGCCATGCGCTTGGCCGCGAGGCGCGCGAGCGAGCGTGCGACCAGGACCATGCTTCGTGCGGTG
GCGAGGAGATCAATTGAGTGGGAAGGCGCCACAGACAAGCGAGCCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAACACCTTCGTACGACC
TTCATCGAGAATGATGGTCGATTACAACCCTCTCGATAGTGACATACCCTGGTTGTGGGAGACCGGCTTAGTGACATTATCTCCTTCCCTGGCAAAATGA
TGGGTACGAGGACGACGACGCGGGGCAACGCGTTCGCTGTGGACGCGCAGGGCGAGGCCGTGCTGCTGAGCTCGCGCGGGCAGCAGGTGATGATGCAGTG
GGAGCGATCGTACATGGAGCGCTGCGTCGCCGCGCTGCGCATCCAGCCATGCGACCGCGTGCTCGAGGTCGGCTTCGGCTTGGCGTACTCGGCGACGCAC
ATCCAGACGTTCCGCCCCCACCGCCACACGATCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCTCGCCGTGCTTGAGCGCGCGCGTGCG
TTTGCATCGCAAAGAAAGGGTGTAGAGATCGCCGACGGCACGTGGCAGACCGTGCTGCCGACGCTTGGCGCGTTTGACTGCGTCTTTTTCGACGACTACC
CGTTGCCCGAACTCGAAGGAGCGACGGACTCGTCAGCGCCGGAGATCTCAGCAAGGTGGGTGCGGTTGAGCAGTGGAAAGGTCTGGACTAGAACACGGGG
CTCATGAGTTTGTCGCTCTGTGTCTGGGGNNNNNNNNNNGGGTCTGGACTGGGACACGGGGCTCATGCGTTTGTCGCTCTGTGTCTGGGGATCTCTGGCG
ATTCTAGACGCTCGCGCTGGCATGACTTTCTGGACGTGGTGCTCCACCACGTGCGTCCCCGTGCGAGGATCACGGGGTACCTCGCACGGTACATTGACCT
CTCACGCGAAGGCTGCGTCGTGGAGATGACACCGATGAATGTGGTGGCGTCATCGAGCTGCAACTACTACCCACATTCTGAGGCGTACGTCCCTATTATC
ACGGTCGTGGATCCGGCGCTGGCAAAGGTCTCCACTCACCATCTCCTGCGAGCACGACTGCACCGTGTCAGGGAACAACTCGTGGTACAGGGCATACTGG
ACGACATACATGACGAGCGAAACGAGCAGCCGTGTGGCGATGGAGATATGGGAGAGCTAGAGAAGGACAATCGACGCGACGGTGACGTCTCAGCAACTGC
GATTTCTCTGGGTGATCCACACAAGGTAGGCGAGGCGGACGAGCCCCCATACGAAGGGTTCCCGTCGCGTAAAGCCTACTTGGCGTCACTGCGATCAAGA
CGCGGCGCAGCATCCAGGTTGATGGCTGACTGTGACGATTCGATGCGAACTTAACGGGCTTGCGAACTTAATCAATCTGTGTGATCGACCATCTGCCATC
AAGAACGACAATAATACCAGAGGATCGACGGCCCTTTCGCATCGCTCTCTTCCTGCCGTCGCTGGCNNNNNNNNNNCTCCGGGCGCACAATAATACCAGA
GGATCTCGACGGCCTTTCGCATCACTCTCTTCCTGCCGTCGCTGGCGACGACCAAGCGAGAACAGAGTTTCCAGACCATCATCCTCCCCAGGCCCATTCA
TATATAGTTATGGCCAGCGGCCGGTCCATCCATCCGCCGCGCGAGTGGCTGTACGTTCAGAAGTATGTGACGCTTGCCGACTTTACGCGCGACTTGAAGA
GCCACAAGATCGGCGAGTACGCCAAGTTGCCAGCCGAGGAAAAGAGACGTCTCTTTGGCTCGAGCATCGTGCCGATCTTTGTGCCGCTCGCGCNNNNNNN
NNNGAAAGAGCAATTCGAGATGCGCTTTGCCGCGTACGCCGAGCGCGTGTCCAGACACACTCTCCGGGCACTGAAAGCCCATGAGGACGAAAAACTCGAG
CGCCGGCTCCGCATGCAATTTGCGATGGCGAACGCCCGAGGCGAAGAGAGATTCAATCCAGGGGACGTGGAGAGCGAGCGACGCCCGGACGACCGCGATG
CGTGTGGCGAGAACGACAGCCACCGCAGCAGTCCCAGAGAACGACGACGACATTACGACGACCGAGGACGTTCGTGGTCTCCTGTGCGGTCGGTAAGTTC
GAGTGGTTCCCATGATCATCGATACGATGAGCAGAGGAGACATGAGAACCACCGGCGAACATCACTCTCTCCTGCTCGCTCGATCAGTTCGAGCGGCTCG
CACGAAATTCAGCGCTACGTCCGCAATCCGTACTCGGGCGAACGCATGCTGCGCGAGGCCTTCTACGTCAGAAAGTATGTCGAGCTCGACCAGTACACGA
TCGACTATAGGCAGTTCAAAATCACCCGCTTGGCGAGAATGCCCGAGCACGAGAAACTGGAGATGTTTGGATCGACTATTGTCCCCATCTATGTGCCGCT
CGCACGAGGTGAGTCGATACGGCAGTACGAAGAGCGCTTCGTCGCGTGGCTTGGCCGACAAGGCTATATGTTGCGCGATGTCGAGACCCACGTCGACGGC
TTGCTTGAGCGCAATTTGCGCATCCAGTTTGCCAACCTCAACGCGAAAGGGATTGAGAAGTTTGTGCGAAGTGAGTCGAAGCGAGACCGAGACAGACCAC
AACGCGATGTAAGCCCTCGGCCAGCGAAAAAAGTCACCCGTGCAGAAGACCGTTCGTCGTCGTCGACCACAGAGCCAAATCGCATGTCAAGTTTGAGCGA
AGGAAAGCTTTCGCTTGGAGAACATATGAAGACTGATGAGAGGTTGCAGACAGGTGCTGCTCACCGAGACTGCTCATTCACTAAGCCACCGGAAGGAGCC
GCGATGTCAACAGTGGCAAATGCGTACATTGCTTGCGGCTGTCGGCGTTGCCTTGTAAGGGGCGTGCAGGTCCTCACAGATGAGGTCACGTCTCTTGGTA
AGACTGCCTGTAGAACATGCCACGCAGCGTCGTCCGAATCCGACAGTGCACATCAACGAAGCGTTGTCGACTTGACGC