Description :
From Genome Similarity Track
Location :
Scaffold_74:83739- 85268
Transcript NameFunction/comments
Phyca_LT1534555519Major Facilitator Superfamily (MFS)

Sequence
1529 bases(100 bases per row)
cacaacgtctggactgcttacgtcttcacgcttttcttctggtctgctcgaaggtgtgtcaaaaaatgtgtcaatttcaatgaacttgcactaattgacc
tcgtttacctgtagcattctcttccagcaggtcgtagctgggtatgtgttcgtgctgacgcaatccaacaagcctgtgggcatcgtcaagggcattcagg
gcatctcccagcttgttttttcacttccaggcggttatttcgctgatcgcatccgtcgagacacgatcctcaagctctcgggcgctattggcgtctttgg
agccgtcatcaccttcttttctgtggaatttacgtctttaaacggcttgtacgtggctttcggcctctggggcctcttcgccgccttccagagcccagca
atggaagctctctttgctgactccatccctcctggaaagaggagcttcccgttcatgatcaagtacaacatcagcaacttagcgcagatgttgggtcctg
tattgagtattttcctctttttattctacggagatcaatggcaacttccagagctcaaacccgtgctggaattcgggtgtgtactagctgtcattggttc
attgatcctgttccagttcaatgatgaccgtgccaaggattatttactggacaagaccgaagaggagaaagaggaggaggttttactagagaaaatgatc
accccatcgcctttgcgtacacccaagctggttggcaacggcaatgagctcgatatggtctacgactattcggatgaagacgacatcacagtggatgaca
attctcctcctacagctacagaaaatactgcgctgctgctattgaagggtaaaaccgcgaaagaaatggacctggaacgacagcagcggttgcaagaggc
ggacgacgatgaagaaggctacatggctcacctcgacgctaaattcctctgcttccgtacgaaacacgtcccgtacatcctgttcatctcggactttgtg
atcagcaatggcgctggaatgaccatcaacttcttccctctcttcttcaaggaggagtacggcctcactcctatccacgtctgcattctctttatgagcc
aaccgctcgtcgtcatgatcctgtcgttcattgcgcagaggttgtcgaagccttgcggccggatgcccattatcgccttcactcgggctttctcagtcgc
ttgtttgttctccatggcctacgcgcagccgatggctctgcagattgcgctgttcctgatgcgaggagggatgatgcggtgttcgcagcctttgcgtcgc
tccatcctcatggattacgtgcccaagaacatccgtgctcggtggaatgcgcttgaaggtctctccgtcttctcctggtctggcagcgcagttctaggcg
gcttcctcatcgatgcgtatggatatcgcgcgtgtttcaccatcacgtcactcgtctactgcgtcgggttgagcttggagatgttcctcttaccactcac
caagcacgcggtggaaagatagaggtaaa