Description :
From Genome Similarity Track
Location :
Scaffold_10:83720- 85187
Transcript NameFunction/comments
Sapdi_VS20SDRG_04025hypothetical protein
Sapdi_VS20SDRG_04026hypothetical protein

Sequence
1467 bases(100 bases per row)
TGGCGCGATATGCACTGCCTCGTGGCGGCTGCGGTCTGCGCACCGGCGACGTAAGCCATTGTCACCACAGTGTGGCGCGTGTGTACCGCTCATAACGACC
GAATGGACTGTTGCCGACCGCTCGCACGACGTGCATGCGCAGCCCATCAAAGTCGCGTCCGTGCATCTCGTACACCGCGTCGTCCGCGTCGCGTGGGTCT
TCATACTCCTACGTCGGTCGGTGAGCCGATGCACGCACTAGCGTTGCGCACCACAAGCGCAAAAGCAGGTCGGCGTGCAGGTCTCTGGACGCGAACGGAT
CGGATGCGTCCAAACCTGGCGAACAGGTTTTGCACGTCAGGCTCCCGCACCGAGTCGGCCAAGTTGCCCACGTGGACTTTGCCCATGGCAGAATTTTCGA
ATCCGATGCAAATCTGGAATTTCGGAATGCCATATCCGGAGGATGATGAAGAGCACTGCCAACACTGCCTTGACGAGTTTACGTGTATACAATGTACAAG
AAGCCATACTATCATGTCAAGCCCAGGGTGTAGAGCTAGGCTGTGTCAACGTTGACGAGTGGGTCCTTGCCGCCGTCGTCCATGTCCAGAAACCAAATGC
CAGGGCCAAGACTCCACGACGTGGGGGGCGCGCCCGGTGCGAAGCGTAGTTTGCTGAGGTCAATGCGCCGAAGCAAGTTTGTTTCGGTAGCTTGCACAAA
GATACAACGCCGAACGTGGTCGCGGACGACGACCCATTCGGTGGCAAACTCAGGGGACACGAGCGGCTGCACGACAGTGTTGAGGAGATGGAGCGCGCGG
GCGACGCCGTTCTGGGCGCTGTCGGGCGAAGTAAAGCTCGTGTCGACGCCGAATACGTCCGTGTTGGCCTGAGCATTGAGGGTCGCGAGCCGCGCAAATC
GATCGGTCGATGAGTATAATGTGCCACCGGAAGTCGTCGAGAGTCGTATCAAGTGCTCCGGGAGCGACGGCGCATTCGTGAGCACACCAAGTGAGTTCCG
AAAGAGGCGCGTCTTTCCATCAAGAAACTCGATGGCGAGTGACTCGCCGAGCGCATCGTGCACCGCAATGTGCATGGGCAGACGACGAAGTGGACCCAAG
CCTGCACGCTGAGCAAGGGGGATATGCATCAGGTCTAAAGCCACGGGCTGGATGGTGTCGAAGCCAGCTACTACGTCGTCAACCGAGGCGAAATTGCCTA
TCACACAATGGTCAGGACAAGTTGACCAATTTCAGAGTGGAGTGGAGTGGACCCAAAATGTAGCTGCATAGGTTGCCAATGGCCGGTCGAAGGTCGTTCG
CATCCACCTCGGGGTAGACTGTTTCCTCCATGAACAGCCAGGCCGCCGACAAGCCTACAACGGTCAATGCTTGGACCGATCAACATCAATTGCACCTTTG
GTGTTGAGGCCATCGGCTGCAAACGGAAGGCTACGCACGTTGAACGAGACGAAGCCGATGGAATTGC