Description :
From Genome Similarity Track
Location :
Scaffold_189:8372- 13673
Transcript NameFunction/comments
Hyaar_Emoy2812203gammasoluble NSF attachment protein putative
Hyaar_Emoy2812204prephenate dehydratase, putative

Sequence
5301 bases(100 bases per row)
AGACGGGACATGACGCTTTCTTTCTGTGATAGGAAAAGGCAGGAAAAATACGATACTTTCTTAGAGGTAAACTTTTGATTCAAGTACTATGTAGAATGGC
CAAAACAAAAATCGATGAAAAATAGAAATCGATGCGTAAAGTACATGGGAGAAAGGGGCCCATTGCTTCTTGTGAGATGAAGATTGTCCAGATGTTGGCC
ACATTATCTGTTTCAGAAACTTCAGCACCAACTCTCTCCTGCCGACGCACTGCATGTGTATCTTCTATTGATTGATGATGCCTTGATCACTGTCGTAGTT
CTGGACAAAAAACACGGAACCGTCAGCATGTCACATGTGTTGATACTGGCCTCACCGCTCGCTTACATATCACACCGAGATCATACTCGCTGCAGTCTGC
AGGTTCTTCATTTCACAGTCAGCATTGTCGAGGGCTCGTTCCGATTGGGGGTCTGTGGGCCAAGTGTGTACACAAAAAGTCAGCTTTGATTCGGGGGTTC
GAGATCACACCAAGAGTACACAAGAAGTCAGCTCTGATCCGGGGGTTCGAGATCACACCAAGAGTACACAAGAAGTCAGCTCTGATCCGGGGGTTCGAGA
TCACATCAGCCTTGTGCGGCGTCAAGAGAAAAACTCGTCTTTGATAGACTCGAACTGGAAGCCAGCGTCGCTGTCTGTTCTCGCCGGTACGCTTTTGTAC
AAAGACTTACTGAACTCGGTCGACATTGGATCGCACCAGGTAGTGTATAATCAGGGAGGCAAAGGTTCCATTCGTTTTTGTCTTAGCCTTCTGTCACACG
CTCTGATAAAATTGCTTCAAGTTTTAACACAAAATCTAGCGCGTCAATTTCAGTAAACTGTCGTATAGTGGATTAAGTCATGATGGTCACGTCACATGCA
GCCAAACACCTCGCCAGCGCAACCCTATCACTGTACTCAACCATTCTCCAATCGAACAATCCCTCTATCTGAATTGTGCAACGTCTCACGCCCTCTCAAA
CACTGACAACTCCTGTTTTTCCTTTTTTATAAATCAAATATCTCTCCGCGGGGGGTGGGGTTACAGCAAGCAAGCAAGCACGCAAAAACGAGCTCGTCGT
CATCGTCATCAGCTGAAGCCATTTCGTATCGTCGCCCTGTAGCTTTATTTTTACCCCAAAATTAGAGTCATCGCTTTATACACGACACAAAACCATCATC
AGAACAACAACTATACCACCACCAGGAGCTACCCACCCGCTTGTCGTTCCAAGTCTCTATTATGTCTCAACTGCAGCAGCAAAAGTGCGTCGAAGCGGCC
GCGCAGCTCAAGCAGGCGGAGAAAGCCCTAACGAGGCGCTCGTTCTTTCGTGGCTCGCCCGACTACCTCTCAGCCGCGCCGCTTCTGGACAAAGCGGGGG
AGCTCTTTCGACTCGGAAATGATTGGGAAGCCAGCAAGGACGCGTTTCGGCGCTGTGCGGACGCTCAACAGCACAACCGACTGCCGTTTCGGGCCGCCCA
GGCGTGGGAAAATGTAGCCAAGACGGTCCTGCAGCAGGTACAAGCGGAGGGGTCCAGTCGGACGGTGTTCAGCCAGAAGTCGCGGACAGGGGAAGCTCGC
CAGGCTTTTGAGAAGGCTAGTGGCTTTTACGTGGACATGGGAGAGTTTGGGAAAGCTGCTGATGCACTTGTTAAGGGAGCACAGGCCTGTGAGAGTCAGG
GGTCTAGTGTGGATGACGTGCTGCCGCTCTACACACACGCGTGCGAGCTCCTCGAAGCCCAAGACAAGCCCCACTTTGCAGTCGAAACGTTTCGAAAGCT
GCAGAGTTTCCTCGTGAAATACGAGAAATACCGCGATGCAATTGCGTTGTTGGACCGTCTGACGGCGTTGTATGAAGCTATGGACCAGCGCCACAATGTG
CACAAGTGCCGCTTGAGCCAAGTCATTCTTCACCTGGCATCGGGGGACGTACCAGCAGCTGATGCTCTTTATTCAAAGTGTTTGCAGGACGACGCGTTCT
TGTCGTCGGATGATTGTGCACTTGCAGAAGACCTCGTACGGGCCTATAAAATGGGCAACGAAGACCTACTGCGAGCAACGGTACGGAAGCCGGGATTTCT
TGCACTCGACAACCAGATTGGACGCGTTAGTCGTAAATTATCGATCTATGGTCCGGGAGATGTTGCGGCTGGTGGTGTGAAGCCGCAAGCTCGGCGCCAG
CATGGGGCAGCACCGTCGTCGAGTATAAAACGCACGCAAGAGCAACAGCAGTCAGGCAAGCAACGCAATCCGTTTGCACCTTCAGCACGAGCACCTCCTG
CCCGACGGAACCCATTTGCACCTTTATCGAGAGCGCCAGTGCCTTCACTAACGTCGGAGTACGAGTCGTCCGAGACACCGACAACAGTGAGCACGGGTAT
CGCCGACAGCGATTACGAAGCTGCATTGTCCGAAGCCCTCAGCACCGTTGCTGTTACAAAAAAGACCAAGACTCATTCACGATCGGCTTCGGTTTCCAAG
AGTCTGCAACCCGTGTCGCCAGAGCCAGTTGGCCCGTCCTTATCGTTTGGGCTATCACCGACCATGGCTTCATCGTCGTCGCCTGCAGCAGTGCGTGCAA
GCGCTTGCATGGATTACGGATGTGACGACCTAGAGTTTGCCATGCCGGATTCCGACTCGCTTGAATTTTTTATGGATGAGCCGACTGGTGCTAACGTGGG
TGGAAGGTCAGGTTCTTTTAGAACGGATATAGCACCGGCATCCAAGACAAAAGCGCCGGCGCGAGAACCAAAACCAACGCCGAAGGCACCCGTGCACGAT
GAATTTGATCTCACATAAAGCAACGAAGGCCATAGCTTGGAGCCAACCGGGTTACGATGTGTTTTAATATTCAGCCGAGTTTGGTCGTTGTATGCCCAGT
CACGTTTGACTCGAGCTGAAGACAGTGTCCATCGGGTACTCGCTGCAGTTTCGCACTAGCCTGACCTTCTAGTTTCATGCTATGAATTTTGTCTGCTTTC
TACCAAGGTTTTTAATGTACACTTGTTCGATGCACGTAACATCTTCTCATTCAGATACTTGCTACACCATCAAGTGGTCATGTTTGTCACTACTTCATTC
ACCCGTAAAATGTCAGTGAACATTTACTCGCTAAAGTTCAGCTTGACTCCAACTATTTCCCTAACAAGCACAAGCCTAAAGGCTCCATGCTTCAACCTCA
CTTGCAACATTATGCTTTTTGCTTTTGCAGTCATTTGGCTTCAAGTAGCTTCGACTCCTTCTAGTGATGCAATATATATGCTACACACTCGTAACGCATA
TACGCTTTATTGGTCTCAAAATTCGCTAAGTGCGTGCCGATCGAATTGCAATTTAAATTACTACTTTTTGTTACCAAAAGTAACAAAAAAGCAGTGACCG
TATGTCCACGACGGCCAGATTCCTGCTACATTCGCTGACCGCTTTCACTACTCCATATTTCACCCAATCATACCACAGCACTTCAACTTACGTATTTTTG
GTCCCCGATGACCTCTACATTCAGACGACATGATTTGCAGCTTCGCCTTCCAGCCACACAAATGTTCACATAATGACAAAATACGCCAACGTTGCGTCCT
CCACCACCCCATGTCGGACGCCCGAGTTCCAACTACAAAAAGCGACAAGAAGCGCAGCTTTACCGTAGCACAGAAGCTCAAGGTCGTGGCCATGTGTAAG
ACGCAGTCCTTGCGATCTGCTGCGCGCCAATTCAACGTCGACCGCAACTGCGTGCGCGCGTGGCGCGACAAAGAAGCAGAACTTCTGGCGCTGCATCCGA
CGGCCAAACGACGACCAGGCGCTGGACGACGACGACAACGGCGGTCGTCGTCAGTTACTTCTTTTACGTCGTCGTCGTTGTCAATTGTCGCACTAACAGA
TGGTCAGCGCAATGTAGACAGGATGATATCAGCCAATGAGAATCGAGCAGCCGTGCGCTTGGAGCAGCATACGCACGTTCAGACAACATCAGCAACAACA
ACGACAGATGGCGATAAGTACGTGCTTGTAGGATTCCAGGGCAAAGAAGGGGCATTCTCTGAAGTAGCAGCAAGGACAGCGTTCGAAGAGCTCCGGTCGA
CCAATCCAGACGCGTTGATCCACAACGAGTTCATGACAGTCGGATTCCCCCATACATCCGACGTCATGGACGCCGTCGAGCGTAACGTCATGACCTTTGG
CGTCCTACCAGTCGAAAACTCGCTCTCGGGCACTTTTCACGGCATTCTCGACCGCCTTGTTGCGTCCCATTTGAAAATCGTAGGGGAAGTCACGTACGTG
CAAGAGCTCTGTCTCTGTGCCTTACCCGGCGTCCAGCTGCACGAGATTGAGACGTTGTCGTCGCATCCAGCTGTTCTGGACCATTGTGAGCGCTTTATCT
ATGCAATGGAACGCTTAAGTGGCAGGATCGTTACTCGAAATGCAGCTTGGGACAGTGCGGGAGCTTGTCAAGACGTGAAGCAGCAGGAGAAGCGCCACGT
TGCTGCTATTGCGAGTGAACAGGCAGCTCTTGCTCATGGACTGGTGGTGCTGGAACGAAGTGTAGGCGACGAGCTCAATAATGAGACGAGGTATATGATT
TTGGGACGATTGGATGCGTCTCCATTGCCATTGGGAACGACAACCACAACGACAACCACAACCAAGTCGAGTATCGTGGTGGCGGTACCAAATGAACCCC
AGGCGCTGTTTAAGATCGTGTCGGCTTTTGCTCTCCGGAATGTGATGATTGTCAAGATTGAGAGTCGTCCAGCAGCGACTGCTGGGCGCCTCTTTTCAGC
GCAGACGACGCACTGGGACTATATTTTCTATATCGACTACATGACAAGCCAAGATTTGACGCAGGAAGCGAGATTGCGTGCGAATCTGGAAGAGTTTGCA
CTGTGGGTCAAAGATTTGGGCACATATGCGAGCAGCAGCGGCAAAACATGCGTCGAACCTCCGCGTTGGACAAGCGTGTTGAACACAATTGCGTGCTGAG
GTTGGCACTTGCTACACGAGCTACAGATATTGTTTCTTTGTCAAAGAGACGCGTAAATGTAATTATCGGGGAAGTCGATGCACTATCGAGATAAAACAGC
CGAATGATGGCAAGTTTATTGAAGGACGTGTCGTAAAAGCGACTTTTGTGACGTCTGACAACACGATTGAGCTCCTGGTAATTCAGCAGAAGATGCTGTT
TGGCCGGCGATGTAAGGTGGTAAAGCCTCGGATGGCTTAGAACTTGTGTAGCTATACATTGACACAACAACGTTCTAAACGTGAAGGAATCGAGACAAAC
G