Description :
From Genome Similarity Track
Location :
scaffold_28:83701- 102924
Transcript NameFunction/comments
Pl_111814conserved hypothetical protein
Pl_111815hypothetical protein PHYSODRAFT_532525
Pl_111816inositol polyphosphate multikinase, putative
Pl_111817hypothetical protein PHYSODRAFT_532795
Pl_111818conserved hypothetical protein
Pl_111819conserved hypothetical protein
Pl_111820conserved hypothetical protein

Sequence
19223 bases(100 bases per row)
CGAAATGAGCTCACGCACTCGCGCATAAGGCGGACCGGGTCCCTTCTTCGAGTTCCATTGCCGCGACCATCCAAATGGCATTCCAGTAGAAAAGGAGCCT
GGTCGCTGTGTGCGTGCTAGCGTGGCGAGCGAGCTTGCGGCGAGCTCCAGAACAAGAGCGCGGCCACGGAGATGGAGGGCGCGGCACCGCGCGAACGAAG
GCGCGGACCTCAAGCAATGCTTGTGCTGCAAGTTGCAGCGAGCGAGCTGGCATCGACGAGCCGTGCACAACACGGACGCCGCCACTACGGTACAGGTCCG
CCCCGCGGTGCTTTCTGCGCGCCAAGCCCTTCTCTTGCATTGGAGCTCGTCACCAAGATCGCGGGCCGATAACGGAGCCCGACGATGCCAAGCAGACCTG
GCGGGCCTTGTCCTGCAAGGCGCAACCCCTAATTGCCACGACGGAGTGTAACTAGCCTACGCTATCACGCTCTCATACATGGCAACGCCCACAGGCAATA
CGGACCAGCGGATCCCGAGGCTGATCCTACGAGCTGGCGCCGCGCTCCAACGACGTCGTCGTCGGGCTGACGAATTCGAGCCTGCTTTGCAATCGTCCTG
GAAACCAGGTGGCCTGCAATGGCCAGGCGCTCTGCGATACGCGAAGAGCCGGGCCTGCACTGTCACCTCATCCTGCAGATCAAGCCTGCCGAGCTGCCAC
GTGCAGTTGTTGCCTGTTACTTCACTGCACACACCAAGCGTTGATGACCCGATGAGCAGGCCGAACGTCTGCATCGCGGAGCTCACGGGCGCCAGAGGGA
GCAGCAAACTTCGGCTTCTGCCTCTCGCGCACTAATGAAATGGGGCCCAGTCCGTGCACGGAGTTAATCTCGCGGTTTCGTAGAGCCATTATTGCTGTGA
CCGCCTTGGCTCTTCTCTCAGTCGGCGCAGCCTTGCAATTCTGAAGTGTAAGGCCGAGGCTGAGCCGACGGCGCGACCGGCGTGGCGCTGTTTCAAACGC
GCCAAAGCGGCCACGGCGCTGACGAAGGTAGAGTCCCTGCTGTCTGCTTCGATGCGGCGAAAAGGTGCACGCAGTCACGTGTAGGCCATTGCAGAGGCAA
GTTGCAGTCGCTACAGTACCTACTCGAGGAGCTCGCAATAATTGCGGCGGTTGAAAGACGGCGGCACATCGTAGGAGCTCGCTGCTGTTCTCGCGGAGCA
AGCAATTCACATCGGCCATGAACTGCCATACAGTTTGACTTGCATTTGGGCGCGCGCGGCTTTGGCACGCTGTTAAATCGCCTGATCCTGGTTCAAATTC
CGCCAATCAGACAGCGGATCGCGCCGTTTGAATCGCGCGCGAGCCGCGGCGATTGGTTCATCTCGCTCACAGTGCCTGCTCTCTCGTCACGCCAGAAAAA
GACGAGGAGATGGGCTGGGACACGCGAAGGGATCTACGGCGAATGGGGTTGTACCTTTGCAGCCGCATCGCCCAGCCGTGATTGGAAGGCCACCGCGACG
GAGGCTCGGCCGCTGATTCACACCGCGCTAAATTAAGACAGCAGTGCTCGGCGACAGCTATGTTTGGCGACAGCTCCGCGCTGGACTCGCCATATCAGTT
GACACGTGTCTCAAGAGAACAGCCACCTTTTTGGGGCTCGGCACACAATTAGACGCGATTCATTGAATCGCAGTGCTCCCCTAGCCCCGCGGCTGCCCCT
TCTTTCCCGTCTGGGCATAGCCAGAACGCGAAGGGGGAGCCTTGGAGAGTGAGTGGTCGTCCTGCGCTTACCATTGTGTTTCCTACCAGGCCGTTGGTAC
TCGCTTCGTCTTCGCGGTGCCCGTCTCCGAGGCCCCAAGTATTTTTTCTGCCGGAGCAGGGGCAGTTAGTTTTATGGCCTCCACGTCCGCGTCCTCGGCG
TCCCAGTCCTCCAGCAGCAGCATGCAGCCGCAAGATTCTTCCGCGCTCGACACCCAGGCCTTCAACTACGACGCGGCCCCGTACCAGCAGTACGCTCATG
AGCGCACAATACACGACCAGGCCGTCCACAGCATGGCCTCCGTCAGCGGCTCGGCCAGCAAGGCCAGCTCAGCGTCGTCCAAGGACGCTTCGCGACCCAA
GACTGAGCCAACGTCTGTTACCACGTCCCCCACGAGCGTCGCCAAGGTCCAGGCCCAAGCCTCCTCCGCAGCGGCTACGACCGCCGCAACGGCCAAGACG
ACACCTGCGCCGGCCCGCAACGAGTCGCTAAAGTCCAATCGCCTTTGCACCATGCCAGGTTGCACCAAGCGCGTACGCTCCAAGGGTCTGTGCAAGGCCC
ACGGTGGTGGCCGACGCTGCATGGTCGACGGGTGCGAGCGCAGCAGTCAGGGCCAGGGCCTCTGCATCCGTCACGGCGGCGGCAAGCGCTGCACGCAGCC
TGGATGCACCAAGGCGTCCCAGTCTAACGGACTCTGCAAAGCTCACGGTGGCGGTCTCCGCTGCCAGAGCCCTGGCTGCACCAAGAGTAGCCAAGGTGGC
GGTTTCTGCCGCGCTCACGGTGGTGGCCAGCGTTGTGAGAAGGAAGGATGCAACAAGGGCGCCCAACGCGGCGGCTTCTGTGCTGGCCACGGCGGCAGCC
GATTCTGCCAGCACCCGGACTGCACCAAGAACGACCGTGGCGGAGGTTTCTGCGCCGAACACGGCGGCGGTAAGCGTTGTGACCACGCTGGATGCAACAA
GCCTGCACGTAAGAAAGGGAAGTGCTCATACCACGCCAACGCCGCCAAGGGCAAGCTTCCAAAGGATCAACTTGCCACGGCTGGAGTTCCTGGCTCGTTG
CCACAGCACATGATGGATATGCGACAGATTACTACGCCTTCATTCGCGATGGGTGTTAAGGATTTGCGTGACCCACATGGTCAGGTTGACCCACAGCGTG
CTGCTTACGTTCAGCAGCAGCGTGTCGAGATGGACATGCGCTACAAGGCCTATGAGGCGTCTGGCAACGGTCAGTATTTGCAGATCCACGCCGACCAGAG
ATCGTATGAGCCCATTAGTCTGCAAGCAGCTGGCGCTGCTCGATACCACATGCCTGTGGACAATGGTTCTCTTCCTCCAGTGTCTGGTAGCATGTACAAG
CCTGGTATGGACCGTCAGGCGTACTCGTCGCGAACCGCCCCTGAACAGATGAAGAACCCGTATACGCAGCACTGGGCGGCCAAGCCGGAGATGCCCCAGC
ACCACCCGGACGGAAGGGTCGACTATTTTGATGTGAACAAGGAGCAGTCACAGCAACAACAGCAACCAGGCCACCACGTGCCGTATCCCACTCAATCGTC
TCAGTATCACCACCACCTTAATGCAGCAGACTCGGCCGCCGCCGCTGCGGCCTATGGTCAGCAGCAACCCCCGCGCGCATACTACAGCCAGCAGCCTCCG
CAAGCTTCATCTAGTGACCAGTCGGCATCTCAGCAGCAAAACATGATGTATTACTCGGCAGCGAACGGGTACCCCCCGCACCCGATGCACAGCATGCAAC
AGCAGCAACAGCAGCAGATGCAGATGTTATAAGCCAGCAATGAAGTGCGGTCGCAAACGAGTCTGCTTTCTTGCACGTCGAGCACTATGAGATGAAGCTG
ATGAACCGAGTGCAAGCGTGAGCGACTCCGAAAGCTGATTGCACTGCTAAAATAGAGATAGAAACAACCGCTATGGATCGGAGTTCCTCTCGCGCGAGGA
AGCGGCAGCAAAGTGTTTATGCCGTCGGCTTGGGAACGTAGCCTTCCACCCAACCAGTTTTGATCGAGCTAAAGGAAGGATTGAGCAAAAGCATTATTCA
CATCAACATGTTTTGTTTTGAGCCTTAAGTCATTATCTATAAGTTGATCGTCCTTGTTCATCTTGCCTACGCCCATGTACAGCGGCACCACCAACATCTT
GGTGCCTTCATGGTGCAGAAGTCTGCAACCAGCATCACCTCCCCCTTCTCTTGCTTGTGCAAGCTCAGACACTTTCGGTGCGAGGCCGAGCTCCTCGACG
GGGCAGAGCCAAAGGCCGCAAAGGTTCACATGTTACAGGACGCTTCTCTAATAAAGATCTGGGTATTCTACGAGCTACTCCGACTGAACTCTGTCGGCGT
GGATGCTCGTCGAGGCAATTCATCGTCTTCGAAGCTGCTCCGTCCAGCTTCGTGTTGCAGTCTGGCTGTGAAGCTGGTAGCTCGTCGTCGTGGTGCTACG
GCTGCTGGGCGTTTCCTACTGGGGCTGTCAGCTGCAGTGGGGCCCCGCACATCTTCAAGCTTGATATTGTGGGCCGCGCCTCGTTTCGACTGTAGCTTGG
CCTGTAGATAGGTGCCGATGGCCGACGTGGGCAGATGCAGAGGCCCAGACGACGAGACCCGAGGCGAGCCGGCCTCCTGGTTGTCGTCCAGAGCCACGCG
AAAGCTGCCCTTGCCCGCGTAATAGTGGCGATAGCACTCCACCAGCTCGTGCTCCATGCCTGCGTACGTCTCCAGTAGCTGCGCAGCCGACGCCTCGTTG
CCCGGCTCGTAGACGTGCAGCAGTCGCTCCAGCTCCGACCGGTAGTCGCCCGCTTCCCGCTGATTGCTAGGGCTGTCTTGGCTCGTGCGCATAATGGAGC
TGCTAGGGATCTCGAAGAAGCCGAAATGGACGCCTTGAGCTCTTGAGCTTTTCGTAATTCTATATTATATTTTCGAAACGGCTTTTTTCCATCGACTTTA
GCTTCAACTAGACCATTTGTCTAGTTTTACCTACACCAATACGAATGTGCTTGTGATCGACAGCACATGCTGCAGTTTTGCAAGTGGCGTTCAGCATATG
ATGAGAAATACACTTGGAGGACTTGCTGTTTACTGCTGGTTCTGGGATTCATGAAGTAGAGTCTGGAAGCACGTGATCAGTGTAGCGATGCCTGTTCGTA
GCCCTTCGTCGAGCTTGGGAGAAGCTGGCTGCGTCGCGTGGGCAAAGTCGATGAGGCGGATGTCAGCTCCGAAGGCCTCTGCCACGGTCGTGTCATCTTC
GACAGATTCTTCGCCGTCGTACAGAAAGAGAAAGGAGCTAGCGATGAACTCCGTCCCTTGTTGCTCATCGAACCACTTCTTCAGTTGATCAAGGCGACGC
AAGAACTGCAAATAGCCAGCAAACAACATAGACCGCAGTAGGAAAAGGAAAGTATAAACAACATATTCTTCACAACCAGGTAATGCAGCAAACTCACCGC
TTCCAACAGTTTGATAGTCTTCGGTGTGTCTTCCACTGGGAAGTAATTTTTAAAGGCTGGAGCGAGCTCATCCTCCGACGTGATGCTGCGACCAAAGTGC
TTGTCGAATTCAACATAGCTCTTTTGTTTGACGTCGAACACTTTGACACCCTGAATACGGAACCCCACCGTCTCCTGCAATGGGAACTTGGACTTCTCGT
ATGCAATTTTCTCGGCCGTCGCAGTGTCTTCGTAAGATCTAGTGCCCATCTTGACATCCATAATGCACGGCCATTGCCTCCTCCATGTCAAGTCCTCCAG
TTCCAAATACTCTGCACACAAAGTCTCATCATAACATTCACCACTCAAAAACTACATGTACATCGTACGTCCAGGGTGCAGCGTCTCCTCTTGTCCGTCC
TCCACCTCAGGGACCACAATTGTGCCGTAATACTTGGGTAAGAACTCCCTGAGAGCCGCAAACTCTGGTGAATCCTTCTCAGACTCGAACACGCGCTCGT
AGAACTCACACTCCCTCTCTCCTCGCTGTTTGTTCTGAAATGGCTTCAAGATGCGTCCATTGTAGGCCTTCAGACCTGCAAAACGATACATCTCATTAGG
AACTAATAAGGCAATTAAGGACACATCTACTAGGTTCATACTCGTCTTGGCTGTGGCGTGGCCGCCGACTTGGTGCGCCATCTCGGTGAAGCCTTTCATC
TTAACTTTTGTGACGTCGAATTGTGTTATAGTCTGCGATTTGGTCTCAACTCAGATTTGATGTTGACACATTAAATATGGCACGCGTGCTAGTGTTGGGC
GGGACGAGTTACGTCGCGCAGTTCGTGCTGCAGCGTCTGCAACAGGACGAAAGGCTTCGAGTAGCGACTGGAGATGCAATGGGAGAGATTGATGCAGTGG
CGTGTACTATTCGCAGCCAACCATTCGCTCCACTTCCGGCAGGTTTCGTGACGGCAGGGTCAGAATCCGCCACTTTGTCGCTGCGGCCTGTGCAAGTGTA
TTGGCAAGTGGATGTGCTGGACTTGAAAGCGCTAGAGAATTGCATCAAACACTTCCATCCAACAGTGATTATTAATTGTACAGGTAAATTATAGTTTTCA
AATATGCAAATAAAATATTTATGCTGATCTGTGTGATGTTGTCAGCCATTTCATCACCGGCAGTTTGCGAGAAGGACCCGGAGAAGGCACGCATCGTCAA
TGAGGTAATAATCTCTTTTCAGTTTTCTTGGGTTAGTGGTGACCGTGGCTGTATTGATGACTAGCCTCGAGATGTAGTAAGTTTGCTGGAAAATTTGCCG
TGGCGCAGTCGATTCGTGCACTTGTCGACAGACTTTGTCTATGAAGGGAAACAATCGTGGGGTAAAAGCTACAAGGAAATTGACGCTGTGAAATCACCGG
AGTTGTCAGTTTATGGTGCTGGGAAACTGCGCTTTGACGAGTTTCTGCTGGAAAATGACAGCTCAGCAAACTTGCAAGTGCTTGTTCTTCGCATTGCGAA
TGTCGTTGGACCGACTGTACCTTTGTTCCCAGACAAGAGTGCGCCAAAGTTCATGGAGTGGCTTCATCATCAATTATTTCAGCCAGATACTGACAGCGCA
CCCCTGAAACTGTGGAGTGACGAGTTCCGCTCATACCTCTACATCATGGACTTAGTCACGATCATGCTCAAACTGCTAGCAATCCGTGCAAGTGAACACA
CTACTCTTGTCAACGTCGGTACGTCGGAAATATGATGAGATAAGCTACTGCTCCTACTTATCAGATCGTACAGGTGGTACGGAGGCACTCTCGCGGGTCG
ATATTGCACACAAGTATCTCGCTGCTTGTGCACAGCACAACCCGGAGGCTGTTGGTAATGTAACAAGAGAGATTGTGCCGGTGTTACGAGCACAGGTTGA
CTTGGGGTATCCTTCACCACTCAACACGAAACTCAGCACTGCACGTCTCACTGAGTTGCTGCCTAATTTCGCGTGGACACCAACGAGTGATATCCTGTGT
GAAATCAGTCGTAGTTTCCTTGAGTGAAAATGTTATTGATTGAAGACATTACTCCTTTGTAGTTGTTAACAGTGAGCGGGGTAAAGAAAATGAGTAGAAC
GATGTCACCTAGTAGCTGTCAACCTACAAAAGAATGCGCGCCCCATTCACGCTCGAAATGATAGAACTCTTCACTTACTGGATCTCCATCACGTTGCCCA
TGTTCTGCCGCGCGTTCTCGAAAGCTTGCACGATGGGATCCTCACCACTGCCCGCGTAGACGAAGTCCGCATCGCAGAGTGCAATCGCGTGACAGGCTTC
GCTGGGGCTCTTTCCCTCGCGTATGAGAGACAGCAGCTCATCAAACTTGGAGGAAAGCGCATCACAGCGCGCACGCGGAGGAAGGATCGTGCACATGGTT
TCCAGCGTCATCTTTGCCTCGCGCAAGGCCTTCTCATTGTCCTTAGCATACTCCAAGAGTTCGGCAGTGTACTCGCAGAACAAGCAGCCCACAGACATAG
ATTTTTCCTCCGGTGCCTCCTTCACGACCGCAGGTTCGCACTCTGCAATTCGAGTGCAGATAGTCTCCACATCTTCGTTCTTTTTCAACGAATCAATGAT
GGCATCTTGGTGTCTCATCAACAGCTCACACTATTTCACACAAAAGAATGATTAGACACAAACATCATATTTGCAAGCGACGAGTGCGGCCGACATTCTC
ACCTCGCTGGACTCTGGAATCAATCGACAAATCGAGTTAATTTCACGCTCGAATGTGGCCAAGCTGTCTGGACGTGTGATTAGCGATGCGAGCAGCAACG
TGTTTTGTCGGCAGGTCGTGCACCTCGAGGGCAGGAAATCCGCGCCTGTGAAGTCAACCAGACCCGACATCAGTGGGCTAGGAGATTTAGTGGCGGCGCA
AAACTTCAGAGTCTGGCAAATCTCTTGGGGTTCCTTTCCAGCTTGTAAATCGGAAACTGCTTCATCAAACATCTTGAGATCGTCATGACACTATTAAGCA
CGCAAACATAAACCAAGATTTGTCAGAATTTCCGCCACCTGAAAGCTGAAACACCTCAATACATACCGTATCGTCAGCAGGAAGTAGTTGGCACACGATA
CCTGCAGCTTCACGCATTTCTTTAACTTGTTCAGGCTTTTGAGCGAGAGCATACTTGAGCACAGTGACCACACCACTGCAATAAGCGCAAGTGCTACTTC
TCTTATCGTGCGTCTGGACAGCGATCATGTCGGGCACCGCAAGCTTGGCCATTGCAGGGTTAGTGTCCGTCGTACAGTACTGAAGATCGTGACAAATAGC
CTTTGGCTGCTCGCCCTTCTGGAGAGAATCAACCACATTGTCGAACTGCTTCACAAACGAGTGGCACTGCAAAATCATACAGAAATATATATCAGCACAA
TCACAGTTTGAAGAAGGTTGTAATCAATGTCCGTACCTGGTTGTCGCTTGGGAGCATCCCGCAAACGACGTCAGCAATTTGTCGAATTTGCGCAATCTTG
CTAGGATCTTCAGCCACGGCCACCTCAATGACAGATGCCACTTGCGTGCAGAAAAAGCATCCGTCAATAGACGCTTCCATTGACTTCTTCACCATTTGAA
CCAGAACTGGATCGTAGGCTGATAAATCGTTGCCCAACGGCAACGATTTAGAGGCGGGCTTGGCTGAGCAATAGTTCATCGACACACAGATTGTGTGCGG
ATGTGTTCCATTCTTCAACGAATCCAGAACAAAGTCCAGTTTTGCAATATACGGTTGACACCCGGACTCTTTTCCCATGAGTTCACAAGCAGTATCCGCC
AACTGCTTAATTTGCTGGATCTTAGTGGCATCTTGTTCATAGGCGGCTTGCACGAGTGTAGTTACATAGTCACAGAAGAAACATGTCTTCGTGTCACTCT
CAGCAGCATCAGTACGACTGTCGACTACCAGAGCTGATACGGTATCGACGAACGAATAATCATCTGCGACCACGTCGACCTTTTTCTTGCAAAGACCAAT
GGACTTGCAGATCTCGTGTGGGCACTTTCCTTCTTTCTCCAGTTCCACGATCTTGTCAAAGTTCTTGTCCACTTCGTCGCATTTGCAGTCGGGTTTTGCC
AATTTGCACACGTTCGTCAATATAGTTTTGACAATTGGGAGCTTTTCAGGCTCGGTTTTGTTGACGTGGTGAATAGCAATACTAACGTGGATGCAGAAGG
AGCATCCGTGATCATGCGGTCGATGTTCTTCAGACCGCAAAGCCACAGCATTTTCTTCATCGTCAGTGATAGCTAGCTGATCTTCCACTGCTGTGCAAAA
CTTGAGCTCCGTGCAAATTGCCTTGGCACTCATTCCCTTAGTGATCGCGTCAATCACGAAGTCAAAATCCTTCACGTAAACGTGGCATGGATTGTCCGAT
CCCAGCATATCACAGATCATATCAGCGTACGTACGAATCTGACGAATGTCTGCGCCGTATTGCTGAAGTGCGATCTTTGCGACGGTGGTGGCGAATTGGC
AGTATGTACACTGAGTTGCATTTCCAGGGGGCCACTGTGAGGCGACAACCACGCCCTTCATTTCATCAGCAATTGAAGGCACATCTTCCTCCCAACCTTG
AGTCTTATTGCAAACTCCAAGCGACTTGCAAATCTCGTGAGGGTGCTTGCCTTCCTTTTCCAATTCTACAATTTTGTCGAAGTTTTTGTCCACAACATCG
CACTTGAGCTTTGAAGGTACCAGTTGGCATACGTTCGTCAAAATGGTCTTCACAATCGGCAGCTTTTCAGGTGACGTGTGGTTGACGTGGTGTATCACCT
TTGCCACACGTGAGCAGAAGAAGCAACTACCATGAGGGTGAGGGCGCGGATGAGGAGGGTGTTCAGTATCTTGAATCAGCGCCATCTCCCCGCGCGGCCT
GTGACCGTGATCGCCATGGCGACCTCCGGGTCCCATCATGCCGACGTGGTGGTGCTTTCCACGAGGACCATTTCGCATCATACCAACACGAGGGTTTTCA
TCCAGATGAGGAGGTATGTCCATACGTGCCGCGGAGCAGTAGTTCAGTGTCTTACAAATGTCACGAGGGTGCACTCCCTTCTTCAAGGAGTCAACCACAG
TGTCCAACTGGTTAGTATACTCGTGGCACGGACTATCATCTCCCAGCGTGCCGCAGATCATGTCAGCGTAATCACGAATTTGGTCAATCTGCTCAGGGGC
CTCTTGCAAGATCACTTCCACAATTGTAGTGGCGACGTCGCAGTACATACAAGTCTTATCACCGCCATCGATCCGATTCAACGGTGTCATGCCAGGCACT
AGCTCTTTGGGGCAGAAATCAGCGTTGGCACAGACGTCGCGAGGGCGCCCACCTTGTTGAACCAGCGCTACAATGCGGTCAAAGTTTGCCTCCACTACAT
GACACTTGGATTCCGGCGAAGCCATCTGGCACACCGTTCCCAAGACCGACTTCAGCATCGGAAGCTGCTCCGGGAACAGGTTGTTAACTTGGTAAATCAC
TCCAGCTACGTGAGTGCAGAAGAAGCACGATTGATCGTTTTCAAAGTCAGATGTGACCAGAGCTCCATCTTCGACCGCCTTGGGGTCTTCCGGAGTCCAC
GGCAGATCTGAAATTTGGTTGTCACTCTCGCTCTCCGACGAGCACATAGCGATCCGAGAGCAGATCACGAGCGGCTCCGTGCCGTGCTTGAGCCAGTCCA
CGATGGCGTCGTAGTTCTTGAGGAACGAGTGGCACATAGAGTCGGCTGACATGGCATCGCACAAGTCTCCGATTATAGCTCGGACCTGCTGCACCTGCTG
GACTTCCTGGGCCAGCGCTTGGTCCACCATCTCCACGAATCTCTGGCACAACTTGCACGACAAATTGTCGGTTCCTTCCAGGTCTGACACGGCGGACATG
ATGTCACACACCTGGTCATCCGTCTTGCCCTCGAGCAGGAACTTCCTCACCACATCCTCCGACTTCAATACGAGATTGCACTTCAATCACAAAAATTAAA
TCAGTATCCTAACTTCAACAACTGAAACCCAATAATTAATTCCTCTTCTTACCTGTTCAACCAGTTCCGGGCGCTCGAGATCTTCGCACGACGCCTCGCC
CCAGACCTGCAGCGAGACCATGTCGACGGCCGAGCGGAAGTAGTTCAGCAGCGTCTCTGCCTGCTGCTGGACTTCGTCCTGCTCGTGCATCTTCTCCAGC
GCCTTCATGCACGCCCTCTTCCTCTCCATCGCCGGGTCCTCCGTCTCCTCTTCAATGATGACAATGCGGATGACGTCGTCCGTCTCCCCGTCCTCCCCGA
GGCGGAAAAAGCTCTGCAGCAGCTCAGCCGACCGCTGGAACTGCTCGTTGAGCACGGCCATGAGATCCATGGCGTTCTCCTCGTTTTCTTCGTGGTGGTA
GGGCATATCAGCCTCCTCCTGGTGGCGTATACCGCGCTCGGCGCTCGCGACGGCCGACGCGGCCGCTAGGCTTAGCAGTAGCGGCACAGACCGCATCCTT
CTCTCTTCAAGCAGCGAATCCTGTTTGAAGGGAAGAAGCGTGTGACTCGAACGACAGGACGGACGTCATTCAAATCGATGCGTGCGCATTCCCCCGTGTA
CACCTCATTTCACGTCATTTCATAGTCAAAGCAAGTGATTGGGCAAGTACTTGCGAACGGACTCTACCAGTCTAATACCGGTTTTAAATACAGAAAGTCG
CCAGGATCAGATGGAAGAAGGGGAGTCACCTCTAACGATTTTGTCGTTGAAGGAATGTTGGTAAATGGCCTTCTTGAAGTGCCGGACCAATCACATGCCG
CGACGACGTATCCGTTGATCGTCTTGACCATCAACGGATCAAGCAGAAGCAAACGTATCGAAATCTATCTTATCTATATTGGAGTCTCTCGATGCTGATC
AACTCACGTTGACCATTGCAGTAAGCTGCAAACTACCACCTTGAGTGGATCGAGGCATCCACAGCAACAATGAGCCGCCACCCGTGCCAGGGAGACCAAG
GAAACCAGGACGCCAGCGATCGAGATACAGCGTCTTCCCTCCTAGTGCCGTGACGTTCGAGCTCCACATGAGTCTCACCAACAGGAACGGCCACTTTGTC
GAACTTGCGTCCACCGGATTTGATGTTCACGACCACATCCTCCGTGTCGACACTTTGGAACGTGATAGTGACTGTACCATCACTACTTTTGACCCATTTT
CCTGTGCTACCTTTGAAGGCGTCTCCGACTGTCTTCAAGCCTAGCGCCTCCTTCGCACTTCCATCATCGATCTCACCTGTGAATTTAGTTGGTCCACAGA
TTGTCTGGAAATACTCGGAAACTACGTGGCCAATGTTCGTTACGTCCCAAACAGCGTAAAAAGCAAGTGCTTTGTCGGCGATTTTGTAGGCATACTTCTC
TGCTGTGAGAAATGTCCCGTTGTGACTCGTACCTGAGTGGATTAGGTCGTCCATGATGCCTCCAAAACTCTTACGGAGCAAATCGCGTGTCGTGTAAGCT
GTATCCTCATCCGACTCGTCGATCAACTCTTCCATGCAGTTATTGGTCACTGTTGGGATTTCGTTGAGTACCAGATTCGACTTGCTCATTTCTACACGGA
CATCGGCCTCGGAGATGTCTGGGTTCTGCTTACGTAGACCTGCCACGGTCATCCATGTGCGATCGAGCAAGCGCTTCATGTTGTATCCACAAGTGGAAGT
AGACTTCAGCGCGGACTGCAGCGAGGAAATGTCAGACTTGTCTAATGAATCAATGGACTTCTCCAGCGCAATTCTCTTCATGAACGCTTTAAATGAGGCC
CAGCTAGCAATGATCGCGTCATTTGTCACAACTTCCTTCACGATGAGCTCGACTGTGTTGGTTATTCTGTCGGCTGTCCTGACTGCCTCTGACACGTGCA
ACCCCAGACACGTACAGATTGTGATAGGCAAGTCGAAGACGACGTTGTCCGTTTGATAGAGAACTGTTTCGAGATATCTTTCTGTCGAGTGAGGATGGGA
AACTTTGATAGTGCGTACAAACTTGGTCAACTGTCTTATCAGGTTCATCATTTCTTTTCCACACTTGTACGCGGTCTTCACACCCTTCGCCATCAGCTTG
AACTCGCCATACAAACCGAACGTGGCGAGTGAGAAAGCTGATTGTGCGATGACCGAAACCTTGGAAACGACTTCGAGCCCACAGTCGTCGTTTTGTCTGA
TGCATTCCATTCCACACTCAATAGGATATGAAATTGGGCATTCCGCCCAGCAAATGTCGTGATGATTGTCGAATTCTAGTGGGCACGCCTTGGCTATATG
AGCTTCACGATAGCAGGCTGTGTCAGATGCACCACCGAGCGAAGGGCCCACCCAGTTCTTATATGTCGACTTAATGGTAGAAATCGTCAATCCCGAAGTC
GTGACATTCGATCCCTCACTGATGCTGTCTAACGATTCGTCGTCGCTATCGCTCTTGTGAGAATCATCGATGTCGTTGCTGGCAGCAGACTAAACGTAGT
CAGCGACTGGAGACACGTCACGGTTTGAGACCGCGTTATCCGCTGATAACAGCGTAGCGCTTGATGTGGATATTGCGGTATCGGTGAAGGTGTAAGTTTG
TGCTGAAGAAAATACGATACCCGCACTCAGCAGGGAACTGCATTGGATCCACTTCAGCATCTTTACTGGTATTGAATTGTCGCGGAAGCAATGTAAAAAG
AAGAATGAGCTTGATATGTGAATGTGCATGGCGCTTATCCAGTAAGTCCGCGAGCTTGCTACAGCGCTACGCGTAGATGTTCGTAGAACGACCTCGCATA
CCGTCGTCGGGTAAGCTTGCTGAACTAGTTTACTGCAAAGCTACTCGGAAAGACGTATCTGTGCGTTTAATCAACTGCTGTAGATCACACTCAGTAATAG
ACAGATTGGATCTGCGAGGTCGTCGTCGATTCCGGTGCAGAACCCAACCTGCAGATATTTCCCTTGGATCAAGTGGTGTTTATGACTTTTGCTTGGTTGA
ACGACTAGACTTCATTTACGCCAAATACGAGACCAACAGTGCTTCGAGGTAACGTTACTGCGAAGGTTAACCAACGATTACTTGCTATCTCACACGATCA
AGTCAGACTCCGGGAGTCCGTCTCAAGGCACAGAAAGACGAGAATTCAGATACAGCAATATTAGTCGCTACTGGTCTCGTCATCATAAAGCGCATATCTT
CCGTGTACAAATGCTCTTGCTGTGGTGTATTTCAATATCACTTCATACTCCAACAATGCGTACCACTCCACGTAATAAGCTGCAAAATTCACAACATTTT
GTAATCGTAGTGCACCAACTTGCTAGCAACTCGACAGGAAGGTTTGTTAGAATTGATTACCGTTTTCGTGTCCATACCCCTGTGTCATTGCAGCTGAGAC
GTGTCCTCTAGGTATGTCCTAAGCAAGCAAACCTCCCACGCGAGGTGAAAAAGGCATTATTTCGCGAGAAGACTGCGCCAGTATCAGCGCTTTGATGAAA
GTGGCCAAATATTCAGCCCACGGAGGTGTGCAAGCAAAACTGAGCACTAACAACGTCACGTTCATGCGTCGTATCAGCGCAATAGCGTGCGCGTTGGAAC
TGCAGATGAAGGAGTAGACAATCCTATCGCTTATACAATTCGTACACTTTATATCCTCCCAGTACACGATAGTATAAAGTACACGATCTTCTGAGTACAA
GCAATTGCTCTCTGCGTACAACAAAAAGTGACGTGGGTACAGAAATATGAGTACTTACAGCAAAAATAACGCTGGGAACTTCAATGATGTATTCTTTAGT
TCTTCCAGATGTACCAGATGCCAATGAAAACGAAAGGGAGAGAATCCATTGCCGATGTTTGTGGACTTTGTGTACAGTTGTTCGTGTACCAGGTGCTAAC
TTGGATGGATAATTATCAAGCGAAATCGCAGTGGGATCGGAGGAAACCGTATCGAGCAACTTGTGTTGTGTTGATCCATTTCAACACCTATAATTTATTT
AATTCTATCATAATTATTTACTTTCATCGTACTCACTACACCAAACACTAATTGAGGTAATACCTCTTCTAAACTCAGCTCACATTGAGTTTCACTGAGA
GCTGCAATTTGCCGCCCTTTGTCGACCGAGGGACCCACAGCAGCAACGAACCACCACCTGTGCCAGGAAGACCCAGAAAACCAGGGCGCCAGCGGTCCAG
GCACAACGTCTTGCCTCCCAGGGTGGTCACATTCGATCTCCAGGTGACAGTCGCACCCGCCGCGACTGTAACTTGGTCGATTTTATCGCCGCCAGACTTA
ATGTTCACAGTCACATCTTCAGTGTCGACACTCTTGAACGTAACAGTGACAGAACCGTCGCCAACCTTGGTCCAATTTCCTTCGCTGTTGTTGAAAGCTG
CCTTCACGGTCTTGAAGCCCAAAGCTTCTTTAACAGTACCATCGTCAATATCACCGACGAACTGTGTGGGTCCGCAAATGGTCTGAAAGAACTCGGACAT
TACACCACCAATATTCTTTCTGTCCCAAACAGCGTAAAATGTCGCTGCCTTGTCAGCGATTTTGTATGCATACTGTCCAGCCGTCAGCAGTGTGCCATTG
CCGCTCGTTCCTGAACTGATTAAATCGTCAATAATGCTTCCAAGGCCCTTGCGCAGAGCTTCCCGCGTGGTATAAGCCGTTGCCTCATCGGACTCGGCAA
TCAATTCTTCCATGCAGTTATTTGTCACAGTAGGAATTTCGTACAGAGCGAGGTTCGACTTGCTCATCGCAACACGGATATCGTCTTCCGAAATGCTGGG
GTTTTGTCGACGCAGCTCTGCTACAGTCATCCAGGTGCGGTCCAGCACTCGCTTCATATCGTAGCCGCACGTCGAGTTGGATTCCAGCGCTGACTGTAAT
GATGTAATCTCGGTCTTGTTCAGCGAGTTGATAGTCTCACCTAGGGTGATGTTCTTCATAAAACTTGTGAATGCGCTCCAACTGGAAACAATAGCGGCAC
CGTTGGCTATGATTTCTTTCAGAGCAAGCTCGCCGGTGTTCACTATTCTGTCCATGAACTTGAATTGCTCGTCCACCTTGATTCCAAGACACGACATAAT
AGTCACTGGAATGTCGAACACGACGTTGTCTGTCTGGTACAACATTGTTAGCAACTTCTCATCGGAATTCGGGTCAGACACCTCGACCGTGCGAACGTAC
TTGCTCAATGCCTTAACCAATCCCATCATCTCTTTGGCACACTTGACTGCGATCTGGACACCCTTCGCCATTAACTTGAACTGACCGTACAAATTGTACG
TAGCTACGGAGAACGCTGCCTGGGCTACGGAAGAAACCTTGCTGACAACCGCAAGCGTACAGTCGTCGTTTTGACGAATGCACTCCATTCCACACTCGAC
GGGGTACGAAAGCGGGCATTGCGCCCAGCACGTTCCAAGCTTGCCATCATATCCGAGCGGGCACGTCTTGGCAATGTGAGCTTTGCGCCAGCATGCCGTG
TCGGGAGCAATACCGAGAGCGGAGCCAATCCAGTTCTTGTAGGCGGACTTGATTGTACTGGTGGCATTGAGTGGGTTGCCCATAGTAAAGCCCGAAAGAG
AGGAGTCACTGTCGTCATTGCTGTCAGATGAATCGTCATCGCTGTCAGAGGAATCGTTGTCGCTAGATCCTTCGTCTTGGCTTTCCTCGGACTCATCGTC
GCTGTCTTCATCGACGAAGGTCACTGTTGTGTTAGAGATGGTTGCAGTGCCATTTACTGTGAAGTTAGCAGCAGCCACTGTTGCAGTTGGTATTGACGCT
GCACTGTTATTAAACGTGATTGATTGTGCTGAAATAGTTGTGCAGAAGACCATCGCATATACGAAGGTCAGTACCAGTAGCAACCTGGTCATTCTTGTCG
GTGCCCAGCGCGCCGCAAAATTAAGAATGAGTTGCCGTTCACCAAACCGCCAAAACACCGAGCCAAACGCCTCTTTTACGAGCGTCCTTGGCTGGTCGTC
TTGCAATGCATCGCATGTGACCGTCTCAATATCGACAGATTCGTGTTGGTTGTGAACACCGTCGTCCAGACAAACAGAAACTTCAGGCTTGTATTGAATC
TATCGTTCCGGCGTGACGACGAATCTTGGCAGGCAAACAGATCAGCAACGGTGAACGGTGACAGGCGCTCCTCCAGTTGTTGGCGCCCCGAGCCTGTGAA
GTGACGGAGACCATATTTCGGAGTACCTTACACATGCCCAGATGGTCACAATTAAACTCGGAGAATTGTGAGTGGGGTTGTCCCCGTGATTCAGTTGGCT
AGCGCTAATGCTTGCCAAGAATCTATAGCCACCACATCCCATGACGTGGAAGAGATATCAACAGGATTGGCCTACCATAGATGAGGCTGTTGTAATGGAT
CGGAGCGTCAGGACGTACATAATCTTAAGTACGTAATGCTAAAACGATTTGCAAACTGCAGATTCCAAGTCGAAGTTGCAGTGGATCAGCTGCAAGCGTC
TGTGCAGCTTCCTACCTTGTATTGTTGCAATTTCGAATGCCTGGATGAAGCGGGAATAGCCTTGACCGACCGTCTCAAACTCATCAATCGTCCTTTACAA
TTATGCGCTTAGATTGGACAAACAGCGAATCTAAATAGCAGCCGTCCTTCACTAGCACCTAGACTGCTGGGCTTACAGCAATTTCTGGACCGCCCCTTGT
CTCCTGCAATGTCCAGGCTGCCTGACGTGATCCCAACGAAGGTCCATGCCTTCTTCTCGAAACTCTATAGCCAACGCTGTAAAATTCCCACTCAACCTGA
CGGTGGCGCTGTTGCCTACACGTAGCAGTGGAGTTAGCAAGTACGTAGCACTAACAATCGTTAATTGCCCAACGGCCCCCTTCCAACCTGACAGGTCATC
CAAACTTTTGTTTGGATGCGAAAGCTCTGCTCCTCAGCGTACGCAAAAACTCCCGTCGTGAGTGCTCATCGGTGTAGTGTATTGACCTGCTGTCTTCTTG
CTGATCACCCCATTTCATCCCCACTCCTGACGAAGGTACTCCTTTATCGATGATATTGTCCTCTTCACCGCCACTCAACTGCTCGTACGAAAGCACATCC
ATTTCTTGAGCAAGAAGGAACTCTCGTATCCCGGCAACGTGTTCTTGCTCTCTCGAAAAACTTGTAGTTTGAGCTAGTCCACTCGCGTTTACATCCTCAA
ATACACGCAAAAACGTCTTCGACATGTATGGTAATGGCAATAGTGCCTCCACTTCATGATTGGATCCGCTTGCAGCATCTCGATCCATTACCGTGATCAC
CGGTACCAGAGCTGTCTTGTGTGGAAAATAGTTACAATGCTCTGGAACATCAACAGGCACACTTGAGACTGTAACTTGACACCCGGGGTGTTGTAAATCT
AGCTTTCGCGCTAGATATCCCGAGATCCTTGTGCCATCTGCACAGTGTTTCAATGCAACATCCAAAAACTCGTGCCAGCGTGACCTACCAACAATTTAAT
AGCAACCCCCTTAGTGCCTCATATTCCCCTCTTGTCCTAACCTTTCAGTCTATTAACTCACCGCTGTCGACCGAAGGCTCGATCACGTGTAGAAGGGTTG
TCAATTTCTAGCTCCGGAAGTGGGTAGTCATCAAAGAAGATGCAGTCGAACTGGTCCAGTGTCGGCAGCCGCTGTTGCCACGTTCCAGCCACGATCTCCA
CTCCTCTGTGACTTGCTGCAAACTGCTGAGCACGTTGCAGCGTCTCCTGATCGCATTCGATGATCGTATGGCTTTTGGGTCGGAATGTCTGGATGTGAGA
CGCCGAGTAGGCCAAACCGAAGCCGATTTCAAGCACGCGGTCCGTCCGTGCGATAGCAAGAGCGTTCACACACTGCTCCATGTACTGCTTTTCCCATTGC
ATCATCACCTGCTGCCCGAGAGAGCTCCAGATCACCTCTTGTCCGAGCTCATCAAGTGCCTTCTTGTTCCCCTGTGTCGTCATTTGTTGTTAAACGAAAT
TGTAATTATCTGTTTTTAGTCCA