Description :
From Genome Similarity Track
Location :
Scaffold_991:8370- 10923
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_991-fgenesh-gene-0.4Ras-like GTP-binding protein YPT1
Pytir_DAOMBR486maker-pir_contig_991-exonerate_est2genome-gene-0.0Gene of unknown function

Sequence
2553 bases(100 bases per row)
TGGGGTGTGGGTTGTGTGGGTTTCGAATGCTGCAGTCGCTGTTTTTCTTCACGTCCTTTCTCGCCCTCGAGATGTTTTCTCTCTCTTTCTCTCTGCCACA
ACAAACACATTCAAGTGCGACCATCTACCGACTTGAGCGCGAGGAAGAAGAAGAGACGCGGGACGAAATGGTTGACGAGGAGTAGACTCTCGCAAGAATG
ACGACGACGCAGCAATAAATCATCCGACCGCTTAGCAGCACTTTCCGCCCGAGCTGGATGGCACATTCTGGCCAGGGGTGAGTCGCACGTTTGGTCCCTT
CGGGGCAACTGGCGCATTCGCCATTCTCTTCTTGATCTGGGCAGCCATCATCATGAACGCCTTCTCAACGTTCGCCGCGTTCTTGGCACTGGTCTCCAAA
AACTCAATTCCCAAGCTGTCCGCGAACTCCTTGGCGGCCTCCGTGCTCACCACACGCTTGGCAGTCAAATCGCTCTTGTTACCGACAAGGAGCTTGTTGA
CATTTTCACAGGCGTATCTGATAATTTGAATACAGAGGATAGGTCAGTACAGAGAAAGCAGAGTGAAGCCATCGACAATCACCAAAGAACGGGAAAAAAA
CAACAACATACCGGTCGATTTCGTGGAGCCACTGCTTGACGTTGTTGAAGGATTCCTGGTCGGTCACATCATACACAACGATGATACCGTGCGCACCGCG
GTAGTAACTGCTAGTGATCGTGCGGAAACGTTCCTGGCCGGCGGTATCCCAGATCTGGAGCTTGATGGTCTTGCCGTCGAGCTCGATCGTGCGGATCTTG
AAATCCACACCGATGGTCGAGATATAGCTCTCCGTGTAGGTGTCGTCAGCAAAACGGAGCAGCAGGCACGACTTTCCGACACCGGAGTCACCGATAAGCA
GGAGCTTGAACAGGTAGTCGCTGCAGCACAAAATCGGAAGCGCACACGTCTAATCGTTAGTCGTCGCCTCGTTTACTCATATAAAGAGAGCTTGTTTGGA
TGCGCAGTGATAGTGACGTACTATTCTGGGTTCATGGTGGATTAATGAAGAGAGAAGAAGAGAGACAATCTGCTCACACACAAACAACAACATATTTCAT
CATTAGCACACCGTTCATCCAAGCAAGAACCCCACAGGTATACACAGGCACACACACACACATCTATACATGCAAGACCACAAAGAAACTAAAAGAAACA
TTGGTGTGGCACTATGATAAGCGATCTCTCGCAGTCCGCCGCCAGCTGGAGGGAGCGGGGAGTATCCATCCTGGCGCTGCCACGCATCCACGCCCGCACC
ATACTGCACCGAACTGCCCTCTTCTTCAAGGCACGCGCACCGTTCCACTCACTCCCATACACATCCACACAGATAGACGTCCACGCTCATTCGTTCACGC
GCAGGCGAGTAGGCTCCTTCCTTTAGCTTCCTTGGCTTACCGAGAGGCGTTTCTTCTGTTTTTTCTTTGACTGAGTTCGGTTGTGAGCGCGGATGTGTGG
GGTTTCTCTGCGAAGAAGAACGCAGGGAAAGAAGGAAGGGGGGAGGCCGCAGCTTTTTTCCAAGGAAGGGAACGCGGGCCGGCGGTAAAAACGGGTGGGT
CCGCGGCAGCCAAACCCGTTGAGGTGACGATTAGGGGAGAAAGAAAATACACCGTGCAGATAAACAGCCAATCGTTGGTGATATAGATAGATAATAGCCA
ATAAAAATGTAGAGCGTGGCGCTGACCAATTTTTAGGCAGAAAATCATTGCACAAAATAGATCTGCTGGGCCATTTCTGGAAAACCACCATCATTCTCGC
TCACAGTACTTGCGTCCGCGCTGATCGAATAGCTTTCTACTTGATTCCACTATGGTAAACGCAGCTGCTAAAACTGGATTCGCCCAGTACATATCATGTG
GACCACGCGCATATGCGAAAACGAACCCATTTTCAGAGTGTAGCCAAGCCGATGCAGATAGATAGCGAAAGTGAATGTGTGTGTGTAGAATCTGGGCACA
AATGGGATTGCACCAACGGAAGAAGCCTTGCTGGCTTGTTGTTTGTGGCGCAGTGGCGTGAGTGGAGGCGCGTTCATTATTATCCACGTAAAAGCGATAG
TTTCTTGGAAGGCAGCCAGGGAGTGCTCTAGGTGTGGGCAGGCTGCGTCTTGTCACGTGAACGCGATGTGACGTGGCATGCGCCTGTGCCCGGTCCAAGT
GCCGCACAGCGACCAGGGCGTGTTGGCTTTGGCTTTACTCGCTGTGACTCGTGGGTACATAACTACTTACACAGTACATTCATCATCCCTTATCATCATA
CGCTCTCTTTCGTGCTGCTGCGCGCTGTCGAGAAAAACGTTTTTGACATGGGTCATTTTTGCGAGCGGCATCTCTGTAAACGCGCCAACGTACGTCGCTT
CTAGAAGAAGCTTCACTCGAGGGCTGCATGAGAGCAGATCACCAGCGCGTACACCACGAGCCACTCATAAGCACGCAGAAAAGTGTCAGCAGAGATCTCC
TTATCTGTTCGTATCAAAGGCGTCGAACTGGTCGGTCGTTCGTGCTCCATTCG