Description :
From Genome Similarity Track
Location :
Scaffold_36:837- 4888
Transcript NameFunction/comments
Phyag_g914hypothetical protein
Phyag_g915hypothetical protein
Phyag_g916hypothetical protein

Sequence
4051 bases(100 bases per row)
CCTTGCGGATGCGGGAGTACGACTAGTTGTCATGAAGCTCGTGATCCGTGGCGTGCTGGTTGACATCATCTATTCGCGAGACTCGTATTTCGCCACCCTG
CGGGAAAATGCTGCGGAGATCGCTCTCGAGGACACGTTCGTTCCAAATGGTAAACCTTAAGTCTGCTCTGTGTCGATGGCTATTTGACTAACGTGTGAGG
TGTTAATGAAATGCAGTCGCATGTGCTGGACCATGCTACTTGGTGCGTCGCTACAGGTGAGACCGAACTCATGCCATTATCACCAATTGATGTGTTGAAG
ACTTACAAGAGCATGAATGTCGACAGTGACGAGGATCtgaagcagttgctgctgtggtgccCAGTGCCCAATGACGCTCCGTCGTCTTTGCTACTCCATC
AACAAATCACAACCAAAGCCAGCAGTCCTGGTGGAAAATCTCGACAAACCTTCGCAGCCAACGATACGCAACTCTATTGTCTTATCGCCAAGCGCTCTCC
ATCGAGAACGAATgctaagaagaagaggaacaagaagaagaagaattcgTCTGAATCGAAGCTAAACGAAAATGATGGAGATGCGGATGATGAGTCTGGC
GATGTTGTGGATGACGCGGTGGTGTTCCAGTTCAACCAGTTTATCTACCACGGAAGTGCAAAGCTTCCTACAAATATGCTGGAGAATCCTGGCGCACTCA
CGTCACGTGGGTTTCCTCTGCTTCGTGCACAAGCAAGTGATCTCGCGTTTGCTGGGGTGTACGAAGAATTACTCGGACCTGGTGGTGAACACGAAGCTGA
ATTTCCTCGGACCAAGCTTTTGAGTCGCTTTGCCACCATTAACAAGCGATTCCAGCAAGAGATCGGATCGGTCCTactcgagctgcttgtggGCGCTCAG
AAATGggtcagcagcttcatggcggAAGTGCCTGTTGCTAGCGGTGGGAACTCATGCATTGCCACATACTTGGCACGTTGGCTGGAGGCCGAGGACGGAA
CCGAGTCATTCTTTGAGCTCGAGTTAGCCCGTGGATCGATCTGTCCGTTTGCTCAAGTTGTAGACGAAGACCATAACCGACCTCCATTGGACTTGCTGGT
CTGGAAAGGAATTGTCCACGATGCACTGCTAGGCATTATCTATCGTCgtggcagcttcttcatgacCCTGGCGCCGATTGCAGGCTCTTCAGACGTTGCG
AGTGACGGTGTACTGGATGATGACGCATCGACGCAGCTTTTTGCTGGTGTTCCACCACAATTGAACAAAGGCCGAGGATATTTGGTTCGTCGATTGCCCA
ACACAGCAGGAACTCCAGCGTGGCTGGCGGGTTCGAAACTGCTTCTGTGGCAAACAAGTCGCAGTCTCGAACGCGAGgagcaagatgaagctcaaaTCCA
AGCCACCGAGAGCAAAACACCGTGCAAGGACTGGTTCGAGGACAGCGATGCGAAAGCAGAATTCAAGGACTCGATGAAAGCTCAAGCGAAGCCACACGCT
CTTCGTCCAGTGGAACCCGCAGGCGACAAGCAGGTTTCGTCTGAATCTGGCACCGCGCTTCCCAAAGCGGACAAGGTGGCGCGACCTCATCACGTTCCTC
GTCTTTCAAGCAGCGAAAGTCTTCTAGCCCTACAAGCGAAGGCGTTGGCTTCACTTCAACCGGTGCCCTGGGATTTACGCACTGGTCGTCCTTTAGGCTA
AAACGTCCATGGTCTTCATTCAACCCAACCACTTGATCACTCGCATTTGCACTACAGCATGAAATACATTTGAAAAAGATAAGCGAAGGTGCACCCCGAC
CGATTTGAATGACCAGTTTTTGAGCAACCACATCGTTATCATTGCTTGCCGACAGCAcggcgtcctcgtccacgaccaATGAGGAAATGAAGAAACCTGC
CAACTAGCACGGGCGAGGCAGGTCTCTTCATTTCCTCATTGACTTCGAGCTGGTAGAAGTGTGTCGGTGGAGTCGCATACAGAGGCTACACGGGAGGCTA
AAGGCTTCTAAGGTGAGAAGTCGTTGTTTGTGGACTTCTAAGATGGTTCTCGAgactcaagacgctgcagaaacaCCCGGATGAACACGTTATCGCCGCC
GCTCACATACAACAAGTTGTGGCTCAGTGGCTCTCGCTGCTTAGGACTGTTATGAGGTACACTCTACGTTACACGAACGGAATCGGTCTCATACTAACTA
GTGAGTTTGTATTATGCAGGTTTAATGAAGAATGAACTGCTTGTTTCGACTGCTTGCGAGTTCtttttgcttttgttttgcgcGGggtcgcttcttcagc
ttccagTTCGAAGTGAGCTCCAACCTGGTGtcgcttgcgctgctcgaagaGCAGAATTTGAGAGCGTGGGATATTCCCTGGCGGCTCGTACATCGCCTCC
CAGTCGACGAGATATAGATCCGTCCCACCACTCGCCTTGGTTTTGCCGATAACCCCCTTTATGTTCCACAGCGCAAAGAAATCGTGACCGGCCATCGCAG
ATTTCAAGGATGCAGCAACGTTGACAGCACCGGACCCGCTCATCAACGAGGTGTCCAAGCGTAGCGCAGCGTTGGCGATAGTGACGGCGGCATCTTCAGA
CTCCACAGCTGCGGCTACAGCACGACCAAGGGCATCTGCGGCAGCAACCGGGCAGCTCCAGAGGCTGGCGTTGGAGCAAATGGTGGTAAGTAGTTTTCCT
GCCATAGTGGTGCTGACCTTGTCGTTACCGGCGCAGGCTGCAGCGAAGTCTCCAAAGGTGTAGACAAGTGCGACCATCGTTGAGTCAGTGCCCTGCGCAA
CCTGTGACGCGCCTACCACCGTGGAGTCTGTTGCCACTGTGCCTTGTGCCGGTATGCCTTTTACGTGCTGTGCTGCCGGCACAAGGATGATCGGCTCTTC
CTGCtgggctgcagcttcggctttGTGACGAACGTTGCGGATGGTCGTATCCGTGATCGTCGTAAGTCCTGCGTTGTTTGCAATGGTAGCGCTCAAAATG
CAATAAACTACtctctctgctgcagcaatgtcTCTAACTTCTACCTTAAGGTCTTTGTACAAGTACTCCCTAGCCTTACCAACCATAGTCACTCCCTCTT
TGAGCTCACTTACCATCTTCTTGCACAGCTCGTGAAATGGACGACGGGTGTACACTTCGTACAGGTAAGGCATCTTGGCTTGGGTACGAAATTCTGAATA
GGCTTCAAAGCAAAGAAAACGGCGCCATCCTTCAGCGTCTCCTGATCACCGTGCAAAGATCAGGAGGACTGGAAACTGACCCCTAGGGAAAGTTTTGTGG
CGCAGTCTCAAGAAGAATctccatgctgcagcttatTCGCTCCGTTGCCTGCTGTTCGTACACTTCGAGAGTGAAAAGGACCGCAGGCGTATGCGCTTGC
TTTTTGCTGGTCGCATGTGGAACACGGCCTGGGCCACACTACGTCTCGACGATCCACCAAGCGCGTCAGAGATCCCAGCTCTCATGGAACGTTTGATGTC
CGTGAGGCCCAACGCGGAGACCAATCTCCTtgacgtggaggacgtgttGCCCATCTTAATCGAGTTGCTGGCTGCGTTGATCAATGCAGATGACGTTGAC
TACTGTCCTCTTCTAGATAAGTTACGCCCTTATCAGCAACGTCGTATGGACCGCGTCTTTGATGCATTGTACCCAAGAGCGCTATCCGATGACACACCGT
TCGCGGATCGcccgaacttctcgtcgtgGTTCAAGATtcgcgagcagcacgctcgtACAAGGATCAACAAGACGATCGAGTCATTCCCTACCACAGCCAA
CTGGGCCGCCAGTGCAGCCGAgcaacaagatcaagaacaCTGGATAGCGCGCAAGTATCGTCTCATGcctactgctgctcagcggcgggtgctcaagcag
ttcaTGGGCACCTGTCGCTGGACATACAACCAAGGGGTGGCGCACTTCAAGGCTACCGCCAAGTACAACCAGGACAACCTGATTACGTTGTGCGTCGCAA
ACAACACCACGCTCGAAAGAAATTACCCAGAGCCAATCAACCCCAAGTTCC