Description :
From Genome Similarity Track
Location :
Scaffold_3139:837- 2620
Sequence
1783 bases(100 bases per row)
TGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGAGGCAGAGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGT
GCAGACGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAATACGCAGAACGACTCCCCTTCGCGATGAATACCGCC
CAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGAATCCCAAATCCACCCTAGAAGCAGCCATTCCAGTGTGTAGCACCAAGAAGA
GGAACCGAGATCCAAGGCGATGGCGGTACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAGGATCG
AGCGGATCGACCCAACGAAGACGCCCGTCCACATCAAATTCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCACGCAAA
TTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGTAGGTACCGAATACCGCCTGTTCCCTG
TGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCCGGATCGGCCGCAGATCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAG
TCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAGGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGG
ACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTC
TTGCGGGAACGTACGAATCGGGACAGATTCGGCTTGATGCAGTATCATGAAGAAGAGTAGGAAGGGGATCCATGGATGTGTGTTGGTCATGTCGATGGGA
GAATGAAGAAGGACCCACAGGAGGGGTGTGGGTCGTGAGGAGGAGGATCGCAGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGG
GAAGGGTGGATTAGGAGGAAGGAGTGAATGGTTATGCATAAGAATGACGTTTTACGTGCGAGGAGTCCTGTTTGATCTCAAGCACGAGCTTTCAAGGGCC
CCTACTATACTGACCCAATTGATCCAGGGTCATTGGCGCTAGATCCGGATGCAATCCAGGCGCAGATCCAACCGGATCCGGGATCCCGCCCAGATCCAGG
TGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACGCTGAAATGGTGGATCCAGCCCAGCTCCAGGTGCACACTGAAAGGGTGGATCAAGACCA
GATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCTGCCCAGATCCAGGTGTACACTGAAAGGCCCGGA
CTAGATTTCTCAACCAACGAGGGAATGTTATGGACATATTCAAGTAAGAGAGTGTGGATTATGATAGCTTATGCGAAGGGTTAGCTCGACCCAGTTTCCA
ACCGCTAGTTACTGCTACGAAACGAATCCACGAAGACTGAAACTGGGGACGTGGCGTCAAAGAGTGATGAGGATCAGGTAGTTTTGGGCTGAACGTTGAA
GAACTTGCCCACTAGACGCTGGATCTGGCGTCCAAAGTGTCTGCTCAAGTCCCCGCGAAACTGGATACGCCAAGAATAGGCTT