Description :
From Genome Similarity Track
Location :
scaffold_1645:837- 2590
Transcript NameFunction/comments
g11600.t1hypothetical protein

Sequence
1753 bases(100 bases per row)
CCAGTAGGACGCCCCGCGCCTACTGGTCCTTGGCGTTTTTTGAACGCCCGCCCGCCTGCACACTCGCTGTGCATTCGCGTGCATAGTGACCGATGTTACT
GCACTTGTAACATCGTACCTTACCACCATTACGCTGCTGTTGACCAGCGGTCGTAGCGCTCGTGAGGTCCATAGGCTCTGGAACTCCCGTCCTTGCTGCA
GGACGCGCCGACTTCGGCGCGTTCGCATGGAGTTTAGCCTGACGCCGGCTAAACCCTTCTTGCATAGCAAGACTGATGGCTTCTTCGAGAGCATTTGGAT
ACTCTCGGAAGAGGTACGTCTTCACGGGGCCGTCCGTCAGTCCCTTCATGAACGTGACGACCTTGGCCGTCTCGTCGACCGGGTTAGCCACTATGTTCGA
TACCAAGTATCGAGCACGCTGGGCATAGGAATGAACATCATCCTTCCCCTGTTGCAGATCGACAAACGCCGCCCTCGATCTGAACTCGTTCTTGGGAGGC
TCAAACGCGAGCTTGAGCTCCTTCTTTAACACCTCGTACGTGCTGAAGCACGTAGGATCCGAGAATCGGCGCCCATAGGCCCAACCCCTCGCACGTCCGC
CAAGACACGACATGGCGAACGCAACCTTCGACAGCGGGTCGACGATGCGTCGAGCCGTAATGGCAGTGTCGAGTTTGACAAGCTAACGAAGGAGGGTCTC
GTCCTCCTTCCCCGTGTAGGTACTCGCGTAGAGCTTTAACGACTCCACGCGCGGCTTCGGGGAAGCCATCAAGGCAGCAACGTCGCGTTGCTTCGTAACA
ATGTACCCCAGAGCAACCCCGTGTTGCTCTGTCGGCGATAGCGTACGAAGCATCATCGCTACCGCCGCCTCTCCGATGACTTGTGAAAGTGGTTGGAGCG
CCTCTCACTCTGGGTCCGACAGGTGGGAACATGTCCGTGCGCGTCACGGACATGTTCGGGGTCCCCGCGGACCCTTCATCCATGGGGAGGTTCTCAACCT
CACGTCCGTATGACTCCATACGAACGAACTGCAGTCGGTCGTGGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTACTTAGACCCACTAGGTGGC
GTACACGTGCGCTCACTTGTATGAGGGAGCGTGCAATTAGTTTAGATTTAACCCTTTCGCGAAGCAAAGGGCCAAACTATACTATACAAAGGTAGGTCAA
TGCCTTGTAAAAGCGCCTTCATGCGCCCTTTTAGAGGCAGATCGCAAGACAGCCCTTGCCTCAAATCCGACAAGATAAACGAGCAGACCACCGCCGACCT
CGTCCAAGGGCGCATGATGTGCCCTTTGAGTTGGCGATCTGATTAGCTTATATTCAGGAGTCTGAAAAAAAATTCAGAAGGATACTCTGATTGGCTAAAA
TAAAGTGGTAAGAAGCTCTTCAGTGGTAACAAATAAAAATTACCACGGCTGATGGCCCCTTCTCTGAACATCATTCATGGCATGATGATGCTTGAGTTTT
GCCTGGCATGAGCACTGGCACCACGTTTGCAACTACTCCAGCTACAAGCACTCTCACGTCTTGTCAACGACACTCCTGTTTTGCTTGATCATTTCCTACG
TGTGCGTGAAGGCCTTAGTATGATTTAGTTAGCAACCTTGGCGATATGTGCTTTGGAATGTCAAAATTAAATTCCTTTTTAGTTTATATATAACAATAAT
AAATATCATTTATATTACATCTAACATTTCAGTTATAGATATACGACCTGTTA