Description :
From Genome Similarity Track
Location :
Scaffold_135:837- 2448
Sequence
1611 bases(100 bases per row)
TATGTTTACGTTGCACACATAAAATCCCACTTTTTAAATACTTTATCAAAAACCACTTTACAGCCGTGCCCAAACCCCGCTTTGAACAGGGAGTCGCGGA
CGAGGTTCTGCCACAGGCGCGCTGCGCCTGCAGCCACCACTTACGAGCGCAGACGGCAACGAAAGATGTAACGCGTCCTAAACATTTGGCCGAGAATATA
CATATGGACAGTCAGTGCTGATGTAGTTGATGTAATTATTATTATTGTTGTTGTTGTTATTAAAGCTTTCTATTGTTAATACCTCTAATATTAGGGAGCC
GTCATACGTACCACACCCTTCTGTTATATGTACCACAGCCCAATTTAAACCAGTAATATTCTTTAGAGCTAACTATTTTGTTATATGTACCACACCCCAT
TTTAGAACATATAAGAATCTTAAGAACCTCCGTACCACATCCTTCTGTTATACGTAAGTCAGCTTAATTTAAATCATTAATATTCTTTGAGACCACCAGG
TATCTCCATTGCATGGTAATTACTTTTTCTAATGCACACGCCGGAGCTCATTATTGTAATACCAGGGAATGGTCTCTGCCGTGTCAAGCGCGACAGTATT
GCAAAAATTGCAGTGGCTCGGAGACTGATAAACGAAATATTCGGTAAAGGTCGGTGAATTTGGACTTGTCAGCTTTGTCAAATGTTTAAAATAAGAAGAA
ACTAGATCTGAGCAAATCGTTGACTCTGTAACAGCAAACAATGAGACAAGAGCGACATGATCGACCTAAGAGAGAGGTGGGACTTGAAGTGGATATGAGC
GGTCATTCAGATCTTGGGAATATATGAATCAGCGCTTAAGACGGCAGAAGTTTGTGTGGCGAGTAGTCACTTCGTGACCGAATTGAATGGAAGGATTCAC
GTTGCCACTCTTGCGTTATGTCGTACCTATTTTCCTAATTGATTACAGACAGTACTGGATAGTCAGATGAAAGCTCCAGAAGCTAATGATGCGCAGATAC
AAGAACTCTCCGATGTCTGTGCGTGAGTTGAAAACTCTAAATTGCTCCGTTGGTAAACATCACATCGTTGCTGAAGAATTTCTAACTGTCAATGTTAACT
TTGCGCTCTACCCAGATACTGTTACGTTACTGCACTCATCTTGGGACTGGGGATTCCGACACTACTAGACGTCGGAAAGGATAAAAAAGAGAGATGAATC
ACGGTTTACTACACTCCTCAACGACGATGCCCAATTCGGACAGCTCATGCAGTCCACTCTATTTGTATTGGCGCCATGTAGAAGTGCAGATGTAAAGGTG
GAGATGAATAGCTGGGAGCGAAAATGCGGTGAGTGCCACGAGGAAGGACACAATAGTCAATCTGTCCCGTTTGACGTCAATCACTATTTTAGTTTCCTCG
TTTCCATTACTTTCTTATCCGGTACTTTTGCATACTTTTAACCAAGTGTCGGTACACACCCATTACTAGTGTCGAAAAGCGTACGTACGACGTCTAGTAT
GTGTCAAGAACTAAGCGAGTTGTGTTCAAGCGCGAGTGTAGTTATTCGATATCAATTTTGTAGCATTAATACTTTTCTGTAGTGCTAGCAGAATGCAAGC
ACCGCTAAAAC